Incidental Mutation 'R0723:Fam214a'
ID63618
Institutional Source Beutler Lab
Gene Symbol Fam214a
Ensembl Gene ENSMUSG00000034858
Gene Namefamily with sequence similarity 214, member A
SynonymsBC031353, C130047D21Rik, 6330415I01Rik
MMRRC Submission 038905-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.433) question?
Stock #R0723 (G1)
Quality Score160
Status Validated
Chromosome9
Chromosomal Location74952884-75032468 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75009451 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 444 (G444E)
Ref Sequence ENSEMBL: ENSMUSP00000150065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081746] [ENSMUST00000170846] [ENSMUST00000214755] [ENSMUST00000215370]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081746
AA Change: G451E

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080442
Gene: ENSMUSG00000034858
AA Change: G451E

DomainStartEndE-ValueType
low complexity region 349 360 N/A INTRINSIC
internal_repeat_1 361 458 7.22e-14 PROSPERO
internal_repeat_1 473 570 7.22e-14 PROSPERO
low complexity region 840 859 N/A INTRINSIC
DUF4210 885 943 8.5e-29 SMART
Pfam:Chromosome_seg 1024 1081 3.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170846
AA Change: G444E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129319
Gene: ENSMUSG00000034858
AA Change: G444E

DomainStartEndE-ValueType
low complexity region 342 353 N/A INTRINSIC
internal_repeat_1 354 451 8.38e-14 PROSPERO
internal_repeat_1 466 563 8.38e-14 PROSPERO
low complexity region 833 852 N/A INTRINSIC
DUF4210 878 936 8.5e-29 SMART
Pfam:Chromosome_seg 1016 1074 1.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214755
AA Change: G444E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215370
AA Change: G444E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.0992 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,691 N341K probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4931423N10Rik T C 2: 23,256,924 probably benign Het
8030411F24Rik T C 2: 148,783,362 I72T probably damaging Het
Acbd5 T G 2: 23,069,596 V54G probably damaging Het
Acin1 A T 14: 54,665,451 S255T probably damaging Het
Adcy2 A G 13: 68,999,129 L56P probably damaging Het
Akap6 G T 12: 53,141,902 C2033F probably damaging Het
Ano5 A G 7: 51,587,758 I777V probably benign Het
Arhgef28 A G 13: 97,939,479 V1349A probably benign Het
Bank1 T C 3: 136,054,403 probably null Het
C2cd5 T C 6: 143,041,555 probably benign Het
Cadps2 A G 6: 23,287,698 V1161A probably damaging Het
Car8 A T 4: 8,169,703 D268E probably benign Het
Ckap5 T A 2: 91,555,331 S175T probably damaging Het
Clk4 T A 11: 51,275,493 Y67* probably null Het
Copg2 T C 6: 30,815,982 I473V possibly damaging Het
Cyp2s1 C T 7: 25,809,548 V43I probably benign Het
Ddx54 A G 5: 120,623,638 D493G probably benign Het
Efemp2 T C 19: 5,480,050 S140P probably damaging Het
Fat1 C A 8: 45,026,749 T2944K probably damaging Het
Fgfr1 T A 8: 25,557,768 D43E probably damaging Het
Fry G A 5: 150,496,360 A996T probably damaging Het
Fyb2 G A 4: 105,015,866 V784I probably benign Het
Gm6507 T A 6: 89,185,162 noncoding transcript Het
Gm7964 T C 7: 83,756,166 noncoding transcript Het
Gucy2c T C 6: 136,727,801 probably null Het
Hdac10 A T 15: 89,126,418 L259Q probably damaging Het
Hoxd9 A T 2: 74,698,828 D258V probably damaging Het
Hs3st3b1 T C 11: 63,921,575 T105A probably benign Het
Hsd17b7 A G 1: 169,956,026 L271P probably damaging Het
Ifnlr1 T A 4: 135,701,213 probably benign Het
Kif22 A T 7: 127,033,906 M121K probably damaging Het
Kl G A 5: 150,953,101 D129N probably damaging Het
Mettl13 A T 1: 162,534,430 I648N probably damaging Het
Mlh1 C T 9: 111,271,472 R18H probably damaging Het
Mtmr14 T C 6: 113,270,512 probably benign Het
Myo15 C A 11: 60,478,977 N854K possibly damaging Het
Myo1h T C 5: 114,319,680 I84T probably benign Het
Myo9a A T 9: 59,871,100 S1380C probably benign Het
Myof A G 19: 37,981,260 V318A probably damaging Het
N4bp2l2 A G 5: 150,662,432 S28P probably damaging Het
Narfl G A 17: 25,781,821 V406M probably damaging Het
Nbr1 C T 11: 101,576,319 Q570* probably null Het
Nhp2 C T 11: 51,619,923 Q36* probably null Het
Olfr23 T G 11: 73,940,270 V8G probably benign Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Poc1b T A 10: 99,129,595 W129R probably damaging Het
Rapgef2 C T 3: 79,079,174 E1018K probably benign Het
Rgs12 T C 5: 35,024,366 probably benign Het
Rufy2 G A 10: 62,998,094 V280I probably benign Het
Snx2 A G 18: 53,210,372 I281V probably benign Het
Spag5 C A 11: 78,319,584 probably benign Het
Stxbp5 A T 10: 9,768,873 I961N probably damaging Het
Tet2 T C 3: 133,467,284 E1739G probably benign Het
Tmod2 A G 9: 75,595,055 F50S possibly damaging Het
Tnfsf13b T G 8: 10,007,166 probably null Het
Ttn T C 2: 76,786,335 K16525E possibly damaging Het
Txnrd2 T C 16: 18,440,879 probably benign Het
Ubr1 A T 2: 120,881,101 Y1437* probably null Het
Vwf C A 6: 125,566,262 D170E probably benign Het
Wdr95 C G 5: 149,574,048 I230M probably damaging Het
Xirp2 C T 2: 67,512,215 S1600F probably damaging Het
Zfp12 A G 5: 143,244,883 K322E probably damaging Het
Other mutations in Fam214a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Fam214a APN 9 75025790 missense probably benign 0.28
IGL00588:Fam214a APN 9 75009581 missense probably damaging 1.00
IGL01887:Fam214a APN 9 75017057 missense probably benign 0.39
IGL02828:Fam214a APN 9 75006432 missense probably damaging 1.00
IGL03060:Fam214a APN 9 75010168 missense probably damaging 0.96
IGL03277:Fam214a APN 9 75009232 missense probably damaging 1.00
R0052:Fam214a UTSW 9 75018983 splice site probably benign
R0052:Fam214a UTSW 9 75018983 splice site probably benign
R0615:Fam214a UTSW 9 75004288 missense probably damaging 1.00
R1428:Fam214a UTSW 9 75006321 missense probably benign 0.07
R1448:Fam214a UTSW 9 75010174 nonsense probably null
R1656:Fam214a UTSW 9 75008959 missense probably benign 0.00
R2024:Fam214a UTSW 9 75010390 missense probably damaging 0.98
R3147:Fam214a UTSW 9 75008838 missense probably benign 0.25
R3745:Fam214a UTSW 9 75009862 missense probably benign 0.00
R4105:Fam214a UTSW 9 75008776 missense probably damaging 1.00
R4224:Fam214a UTSW 9 75008726 missense probably damaging 1.00
R4496:Fam214a UTSW 9 75031531 missense probably damaging 0.99
R4519:Fam214a UTSW 9 75023647 missense probably damaging 1.00
R4715:Fam214a UTSW 9 75012968 missense probably damaging 1.00
R4885:Fam214a UTSW 9 75006367 missense probably damaging 1.00
R5009:Fam214a UTSW 9 75008889 missense probably damaging 0.98
R5574:Fam214a UTSW 9 75010390 missense probably damaging 1.00
R5645:Fam214a UTSW 9 75025679 missense probably damaging 1.00
R5696:Fam214a UTSW 9 75010117 missense probably benign 0.01
R5891:Fam214a UTSW 9 75004386 missense probably damaging 1.00
R5936:Fam214a UTSW 9 75009304 missense probably benign 0.00
R6165:Fam214a UTSW 9 75025672 missense probably damaging 0.96
R6228:Fam214a UTSW 9 75006363 missense possibly damaging 0.94
R6419:Fam214a UTSW 9 75009337 missense probably benign 0.20
R6499:Fam214a UTSW 9 75023648 missense probably damaging 1.00
R6631:Fam214a UTSW 9 74953825 missense possibly damaging 0.71
R6649:Fam214a UTSW 9 75010150 missense probably damaging 0.96
R6849:Fam214a UTSW 9 75009312 missense probably damaging 0.96
R7189:Fam214a UTSW 9 75004351 missense probably damaging 0.99
R7402:Fam214a UTSW 9 75006386 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCATTGCCAGGATTGCTCAGCAC -3'
(R):5'- CTAGGTTTGAGGCTTTCCCCATCAC -3'

Sequencing Primer
(F):5'- GGATTGCTCAGCACTTGATTCAC -3'
(R):5'- AGGACACTTCTGTATGAGACAC -3'
Posted On2013-07-30