Incidental Mutation 'R8211:Krt26'
ID636180
Institutional Source Beutler Lab
Gene Symbol Krt26
Ensembl Gene ENSMUSG00000075570
Gene Namekeratin 26
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R8211 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location99328550-99337966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99335284 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 195 (D195N)
Ref Sequence ENSEMBL: ENSMUSP00000098051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100482]
Predicted Effect probably damaging
Transcript: ENSMUST00000100482
AA Change: D195N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098051
Gene: ENSMUSG00000075570
AA Change: D195N

DomainStartEndE-ValueType
low complexity region 40 65 N/A INTRINSIC
Filament 79 394 1.1e-132 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin superfamily. This keratin protein is a type I keratin that is specific for the inner root sheath of the hair follicle. This gene exists in a cluster with other keratin genes on chromosome 17q21. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,329,435 I28V possibly damaging Het
A330017A19Rik A G 17: 46,890,383 probably benign Het
Adamtsl3 T C 7: 82,523,163 S445P probably damaging Het
Afp T C 5: 90,501,486 I304T possibly damaging Het
Alk G A 17: 71,869,707 A1534V probably benign Het
Ank3 C T 10: 69,867,398 P287L unknown Het
Appl1 T C 14: 26,945,598 I367V probably benign Het
Arpin T A 7: 79,935,244 M1L probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
B430203G13Rik A T 12: 17,924,539 H82L noncoding transcript Het
Bcl11a T A 11: 24,078,394 S2T probably damaging Het
Cfap46 T A 7: 139,633,304 M1605L unknown Het
Chga C A 12: 102,561,419 Q111K possibly damaging Het
Drc7 A G 8: 95,056,079 E24G unknown Het
Dst T C 1: 34,212,451 L2195P probably damaging Het
Enpp5 G A 17: 44,081,511 probably null Het
Fat2 A G 11: 55,312,209 L13P possibly damaging Het
Grhl1 T C 12: 24,586,152 probably null Het
Ikbke A G 1: 131,271,778 I326T probably damaging Het
Lamc2 A T 1: 153,166,278 C37S probably damaging Het
Lrriq1 A G 10: 103,170,547 L1239P probably damaging Het
Mrps5 T A 2: 127,603,724 H390Q probably benign Het
Nphp3 T A 9: 104,031,897 C769S possibly damaging Het
Obscn A G 11: 59,115,794 S1181P probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pabpc6 G T 17: 9,669,457 A55E probably damaging Het
Pcdha9 A T 18: 36,998,859 E327V possibly damaging Het
Pds5b A G 5: 150,728,942 T225A possibly damaging Het
Pi4ka A C 16: 17,282,905 I1807S Het
Pick1 T A 15: 79,248,730 I330N probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rubcn A C 16: 32,836,543 C502W possibly damaging Het
Slc26a10 G A 10: 127,173,965 R571C probably benign Het
Slc44a2 A T 9: 21,348,138 N587Y probably damaging Het
Slfn2 T G 11: 83,069,759 V188G possibly damaging Het
Smok2b T C 17: 13,235,793 V280A probably benign Het
Snx19 A G 9: 30,437,465 E798G probably benign Het
Sspo T C 6: 48,492,609 probably null Het
Ugt2b37 T C 5: 87,242,376 I404V probably benign Het
Vmn1r160 T C 7: 22,871,326 F35L possibly damaging Het
Vmn1r193 A T 13: 22,219,116 Y235* probably null Het
Vmn2r53 T C 7: 12,581,916 I659V probably benign Het
Vmn2r91 A G 17: 18,106,500 D349G probably damaging Het
Zfp292 A T 4: 34,806,163 S2299T probably benign Het
Zfp938 T C 10: 82,226,585 N67S possibly damaging Het
Other mutations in Krt26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Krt26 APN 11 99331281 missense probably benign 0.00
IGL02019:Krt26 APN 11 99333645 missense probably benign 0.30
IGL02138:Krt26 APN 11 99333645 missense probably benign 0.30
IGL02188:Krt26 APN 11 99333645 missense probably benign 0.30
IGL02189:Krt26 APN 11 99333645 missense probably benign 0.30
IGL02192:Krt26 APN 11 99333645 missense probably benign 0.30
IGL02647:Krt26 APN 11 99333645 missense probably benign 0.30
IGL02651:Krt26 APN 11 99333645 missense probably benign 0.30
R0122:Krt26 UTSW 11 99333719 nonsense probably null
R1842:Krt26 UTSW 11 99333526 small deletion probably benign
R1843:Krt26 UTSW 11 99333526 small deletion probably benign
R1923:Krt26 UTSW 11 99333526 small deletion probably benign
R1924:Krt26 UTSW 11 99333526 small deletion probably benign
R3872:Krt26 UTSW 11 99334744 missense probably damaging 1.00
R3873:Krt26 UTSW 11 99334744 missense probably damaging 1.00
R3874:Krt26 UTSW 11 99334744 missense probably damaging 1.00
R3875:Krt26 UTSW 11 99334744 missense probably damaging 1.00
R4014:Krt26 UTSW 11 99335302 missense probably damaging 0.99
R4939:Krt26 UTSW 11 99334696 missense probably benign 0.03
R5620:Krt26 UTSW 11 99337771 missense possibly damaging 0.86
R6035:Krt26 UTSW 11 99333589 missense probably benign 0.43
R6035:Krt26 UTSW 11 99333589 missense probably benign 0.43
R6151:Krt26 UTSW 11 99337489 missense probably benign 0.35
R6578:Krt26 UTSW 11 99334802 missense probably damaging 1.00
R6626:Krt26 UTSW 11 99329702 missense probably benign 0.28
R7413:Krt26 UTSW 11 99335061 missense probably benign 0.25
R7557:Krt26 UTSW 11 99334741 missense probably damaging 1.00
R7919:Krt26 UTSW 11 99333594 missense probably damaging 1.00
R8051:Krt26 UTSW 11 99337846 missense probably damaging 0.97
R8090:Krt26 UTSW 11 99336489 missense probably benign 0.13
R8163:Krt26 UTSW 11 99329672 missense probably benign 0.00
R8480:Krt26 UTSW 11 99337600 missense probably damaging 1.00
Z1186:Krt26 UTSW 11 99337817 missense probably damaging 0.99
Z1191:Krt26 UTSW 11 99337817 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGAGGATTTCAGTTGACATCC -3'
(R):5'- CCCAAACCATCTTAATAGTTTGCC -3'

Sequencing Primer
(F):5'- GAGGATTTCAGTTGACATCCACATCC -3'
(R):5'- TGCCATTGCAAGAAACCTTGG -3'
Posted On2020-07-13