Incidental Mutation 'R0723:Mlh1'
ID63620
Institutional Source Beutler Lab
Gene Symbol Mlh1
Ensembl Gene ENSMUSG00000032498
Gene NamemutL homolog 1
Synonymscolon cancer, nonpolyposis type 2, 1110035C23Rik
MMRRC Submission 038905-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0723 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location111228228-111271791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111271472 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 18 (R18H)
Ref Sequence ENSEMBL: ENSMUSP00000035079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035079] [ENSMUST00000060711] [ENSMUST00000135218] [ENSMUST00000135807]
Predicted Effect probably damaging
Transcript: ENSMUST00000035079
AA Change: R18H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035079
Gene: ENSMUSG00000032498
AA Change: R18H

DomainStartEndE-ValueType
HATPase_c 23 158 4.57e-1 SMART
DNA_mis_repair 216 335 1.08e-44 SMART
low complexity region 363 375 N/A INTRINSIC
low complexity region 429 454 N/A INTRINSIC
Pfam:Mlh1_C 504 760 8.3e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134316
Predicted Effect probably damaging
Transcript: ENSMUST00000135218
AA Change: R18H

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000135807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200053
Meta Mutation Damage Score 0.4159 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). It is a human homolog of the E. coli DNA mismatch repair gene mutL, consistent with the characteristic alterations in microsatellite sequences (RER+phenotype) found in HNPCC. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described, but their full-length natures have not been determined.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced pairing in meiotic prophase I and produce no mature germ cells. Mutants also display increased microsatellite instability and a predisposition for developing intestinal and other tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,691 N341K probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4931423N10Rik T C 2: 23,256,924 probably benign Het
8030411F24Rik T C 2: 148,783,362 I72T probably damaging Het
Acbd5 T G 2: 23,069,596 V54G probably damaging Het
Acin1 A T 14: 54,665,451 S255T probably damaging Het
Adcy2 A G 13: 68,999,129 L56P probably damaging Het
Akap6 G T 12: 53,141,902 C2033F probably damaging Het
Ano5 A G 7: 51,587,758 I777V probably benign Het
Arhgef28 A G 13: 97,939,479 V1349A probably benign Het
Bank1 T C 3: 136,054,403 probably null Het
C2cd5 T C 6: 143,041,555 probably benign Het
Cadps2 A G 6: 23,287,698 V1161A probably damaging Het
Car8 A T 4: 8,169,703 D268E probably benign Het
Ckap5 T A 2: 91,555,331 S175T probably damaging Het
Clk4 T A 11: 51,275,493 Y67* probably null Het
Copg2 T C 6: 30,815,982 I473V possibly damaging Het
Cyp2s1 C T 7: 25,809,548 V43I probably benign Het
Ddx54 A G 5: 120,623,638 D493G probably benign Het
Efemp2 T C 19: 5,480,050 S140P probably damaging Het
Fam214a G A 9: 75,009,451 G444E probably damaging Het
Fat1 C A 8: 45,026,749 T2944K probably damaging Het
Fgfr1 T A 8: 25,557,768 D43E probably damaging Het
Fry G A 5: 150,496,360 A996T probably damaging Het
Fyb2 G A 4: 105,015,866 V784I probably benign Het
Gm6507 T A 6: 89,185,162 noncoding transcript Het
Gm7964 T C 7: 83,756,166 noncoding transcript Het
Gucy2c T C 6: 136,727,801 probably null Het
Hdac10 A T 15: 89,126,418 L259Q probably damaging Het
Hoxd9 A T 2: 74,698,828 D258V probably damaging Het
Hs3st3b1 T C 11: 63,921,575 T105A probably benign Het
Hsd17b7 A G 1: 169,956,026 L271P probably damaging Het
Ifnlr1 T A 4: 135,701,213 probably benign Het
Kif22 A T 7: 127,033,906 M121K probably damaging Het
Kl G A 5: 150,953,101 D129N probably damaging Het
Mettl13 A T 1: 162,534,430 I648N probably damaging Het
Mtmr14 T C 6: 113,270,512 probably benign Het
Myo15 C A 11: 60,478,977 N854K possibly damaging Het
Myo1h T C 5: 114,319,680 I84T probably benign Het
Myo9a A T 9: 59,871,100 S1380C probably benign Het
Myof A G 19: 37,981,260 V318A probably damaging Het
N4bp2l2 A G 5: 150,662,432 S28P probably damaging Het
Narfl G A 17: 25,781,821 V406M probably damaging Het
Nbr1 C T 11: 101,576,319 Q570* probably null Het
Nhp2 C T 11: 51,619,923 Q36* probably null Het
Olfr23 T G 11: 73,940,270 V8G probably benign Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Poc1b T A 10: 99,129,595 W129R probably damaging Het
Rapgef2 C T 3: 79,079,174 E1018K probably benign Het
Rgs12 T C 5: 35,024,366 probably benign Het
Rufy2 G A 10: 62,998,094 V280I probably benign Het
Snx2 A G 18: 53,210,372 I281V probably benign Het
Spag5 C A 11: 78,319,584 probably benign Het
Stxbp5 A T 10: 9,768,873 I961N probably damaging Het
Tet2 T C 3: 133,467,284 E1739G probably benign Het
Tmod2 A G 9: 75,595,055 F50S possibly damaging Het
Tnfsf13b T G 8: 10,007,166 probably null Het
Ttn T C 2: 76,786,335 K16525E possibly damaging Het
Txnrd2 T C 16: 18,440,879 probably benign Het
Ubr1 A T 2: 120,881,101 Y1437* probably null Het
Vwf C A 6: 125,566,262 D170E probably benign Het
Wdr95 C G 5: 149,574,048 I230M probably damaging Het
Xirp2 C T 2: 67,512,215 S1600F probably damaging Het
Zfp12 A G 5: 143,244,883 K322E probably damaging Het
Other mutations in Mlh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Mlh1 APN 9 111252912 missense possibly damaging 0.84
IGL02530:Mlh1 APN 9 111229875 missense probably benign 0.09
IGL02811:Mlh1 APN 9 111271514 missense probably benign 0.04
IGL02892:Mlh1 APN 9 111252969 missense probably benign 0.00
IGL03394:Mlh1 APN 9 111268243 missense probably damaging 1.00
andalusia UTSW 9 111271410 makesense probably null
andalusia2 UTSW 9 111271523 start codon destroyed probably null 0.93
andalusia3 UTSW 9 111229838 critical splice donor site probably null
ANU23:Mlh1 UTSW 9 111252912 missense possibly damaging 0.84
PIT4495001:Mlh1 UTSW 9 111247260 missense probably benign 0.00
R0496:Mlh1 UTSW 9 111241556 missense probably benign
R1395:Mlh1 UTSW 9 111247377 missense probably damaging 1.00
R1694:Mlh1 UTSW 9 111228475 missense probably damaging 1.00
R1762:Mlh1 UTSW 9 111229929 missense probably damaging 1.00
R1865:Mlh1 UTSW 9 111257024 intron probably benign
R1885:Mlh1 UTSW 9 111258556 missense probably benign 0.18
R1992:Mlh1 UTSW 9 111228563 missense probably damaging 0.96
R2186:Mlh1 UTSW 9 111258566 unclassified probably benign
R2680:Mlh1 UTSW 9 111236017 critical splice acceptor site probably null
R4693:Mlh1 UTSW 9 111255658 missense probably damaging 1.00
R4784:Mlh1 UTSW 9 111239798 missense probably benign
R5007:Mlh1 UTSW 9 111271410 makesense probably null
R5130:Mlh1 UTSW 9 111229838 critical splice donor site probably null
R5166:Mlh1 UTSW 9 111241513 missense probably benign 0.04
R5265:Mlh1 UTSW 9 111271523 start codon destroyed probably null 0.93
R5481:Mlh1 UTSW 9 111229837 splice site probably null
R5483:Mlh1 UTSW 9 111231058 missense possibly damaging 0.82
R5602:Mlh1 UTSW 9 111252878 missense probably damaging 0.97
R5658:Mlh1 UTSW 9 111247380 missense probably damaging 0.99
R5890:Mlh1 UTSW 9 111228495 missense possibly damaging 0.88
R6810:Mlh1 UTSW 9 111241558 missense possibly damaging 0.52
R7607:Mlh1 UTSW 9 111229890 missense probably damaging 1.00
R7753:Mlh1 UTSW 9 111252863 critical splice donor site probably null
R7912:Mlh1 UTSW 9 111261513 missense possibly damaging 0.69
R7977:Mlh1 UTSW 9 111230077 intron probably null
R7993:Mlh1 UTSW 9 111261513 missense possibly damaging 0.69
R7995:Mlh1 UTSW 9 111235921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATGGGAAACCAGCCTGGCAC -3'
(R):5'- ACTGGCATTCATGCTGCCCAATC -3'

Sequencing Primer
(F):5'- GTCCCTGTGCCCGATGC -3'
(R):5'- GCTGCCCAATCAGCACTTG -3'
Posted On2013-07-30