Incidental Mutation 'R8212:Sppl2b'
ID636217
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Namesignal peptide peptidase like 2B
Synonyms3110056O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R8212 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80855275-80868708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80865359 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 356 (V356D)
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597]
Predicted Effect probably damaging
Transcript: ENSMUST00000035597
AA Change: V356D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206
AA Change: V356D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,522,121 I2369V probably benign Het
Ager G A 17: 34,600,612 R368H possibly damaging Het
Arl2 G T 19: 6,137,566 T84K probably damaging Het
Cfap126 A T 1: 171,126,061 T67S probably damaging Het
Cfap45 A G 1: 172,541,500 probably null Het
Cfdp1 A T 8: 111,845,183 N31K probably damaging Het
Clpx A G 9: 65,320,891 T408A possibly damaging Het
Cobll1 T C 2: 65,102,080 N526S probably benign Het
Cpne1 T C 2: 156,078,214 D215G probably damaging Het
Cstf1 T C 2: 172,377,952 S328P probably damaging Het
Cyp2a22 T C 7: 26,937,780 E193G possibly damaging Het
Fam83c A G 2: 155,829,287 F743L probably benign Het
Fn1 A G 1: 71,642,905 I364T probably benign Het
Foxo3 T C 10: 42,196,995 M509V possibly damaging Het
Galnt6 T C 15: 100,693,427 T599A probably benign Het
Gm5114 A G 7: 39,411,252 S58P probably benign Het
Gria4 G A 9: 4,480,242 A402V probably benign Het
Heatr5a C A 12: 51,899,229 A1200S probably benign Het
Nlrp5 A T 7: 23,417,337 D162V probably benign Het
Olfr127 T C 17: 37,904,257 V237A probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pcf11 G A 7: 92,659,498 R589C probably damaging Het
Pkhd1l1 A G 15: 44,499,300 D574G probably benign Het
Plb1 T C 5: 32,264,906 S68P probably damaging Het
Plekhs1 A G 19: 56,471,756 M95V probably damaging Het
Polr2h T C 16: 20,717,996 probably null Het
Ppef2 T A 5: 92,228,665 I668L possibly damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rwdd1 A G 10: 34,002,527 V104A probably damaging Het
Slc2a9 G T 5: 38,480,059 H25N probably benign Het
Slc36a3 T A 11: 55,125,081 I416F probably damaging Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Tln1 T C 4: 43,555,918 T99A probably damaging Het
Tm9sf3 A T 19: 41,240,635 M243K probably damaging Het
Trnt1 T C 6: 106,769,871 Y6H probably benign Het
Ttn T A 2: 76,782,282 H17151L probably benign Het
Ube2o A G 11: 116,548,798 V182A possibly damaging Het
Zfhx2 G T 14: 55,072,916 D724E possibly damaging Het
Zfp616 T A 11: 74,085,743 V946D probably damaging Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80864094 missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80865341 missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80861386 missense probably benign 0.00
IGL01964:Sppl2b APN 10 80865386 critical splice donor site probably null
IGL02376:Sppl2b APN 10 80867598 nonsense probably null
R1641:Sppl2b UTSW 10 80865131 missense probably damaging 0.96
R2228:Sppl2b UTSW 10 80865617 missense probably damaging 1.00
R3104:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R3106:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R4350:Sppl2b UTSW 10 80862726 missense probably benign 0.12
R5146:Sppl2b UTSW 10 80867640 makesense probably null
R5698:Sppl2b UTSW 10 80866045 splice site probably null
R6969:Sppl2b UTSW 10 80865125 missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80867419 missense probably benign 0.02
R8263:Sppl2b UTSW 10 80866069 frame shift probably null
R8265:Sppl2b UTSW 10 80866069 frame shift probably null
R8367:Sppl2b UTSW 10 80863191 missense probably benign 0.02
R8398:Sppl2b UTSW 10 80866068 frame shift probably null
R8398:Sppl2b UTSW 10 80866069 frame shift probably null
R8400:Sppl2b UTSW 10 80866069 frame shift probably null
R8480:Sppl2b UTSW 10 80866069 frame shift probably null
R8481:Sppl2b UTSW 10 80866069 frame shift probably null
R8505:Sppl2b UTSW 10 80866069 frame shift probably null
R8817:Sppl2b UTSW 10 80866069 frame shift probably null
R8818:Sppl2b UTSW 10 80866069 frame shift probably null
R8832:Sppl2b UTSW 10 80866069 frame shift probably null
Z1176:Sppl2b UTSW 10 80867425 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GTACATGCTGAAGACCATCCG -3'
(R):5'- AGATGTCTCCAAAGCCCAGG -3'

Sequencing Primer
(F):5'- TGAAGACCATCCGCCTGC -3'
(R):5'- TTCAGCACCATGGGCAG -3'
Posted On2020-07-13