Mutagenetix > Incidental Mutation

Incidental Mutation 'R8212:Sppl2b'

636217

Institutional Source

Beutler Lab

Gene Symbol

Sppl2b

Ensembl Gene

ENSMUSG00000035206

Gene Name

signal peptide peptidase like 2B

Synonyms

3110056O03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.854) question?

Stock #

R8212 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80855275-80868708 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80865359 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 356 (V356D)

Ref Sequence

ENSEMBL: ENSMUSP00000036289 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035597]

AlphaFold

Q3TD49

Predicted Effect

probably damaging
Transcript: ENSMUST00000035597
AA Change: V356D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206
AA Change: V356D

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	25	36	N/A	INTRINSIC
Pfam:PA	55	147	5.5e-14	PFAM
transmembrane domain	167	189	N/A	INTRINSIC
PSN	210	485	2.16e-113	SMART
low complexity region	520	531	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	T	C	13: 81,522,121	I2369V	probably benign	Het
Ager	G	A	17: 34,600,612	R368H	possibly damaging	Het
Arl2	G	T	19: 6,137,566	T84K	probably damaging	Het
Cfap126	A	T	1: 171,126,061	T67S	probably damaging	Het
Cfap45	A	G	1: 172,541,500		probably null	Het
Cfdp1	A	T	8: 111,845,183	N31K	probably damaging	Het
Clpx	A	G	9: 65,320,891	T408A	possibly damaging	Het
Cobll1	T	C	2: 65,102,080	N526S	probably benign	Het
Cpne1	T	C	2: 156,078,214	D215G	probably damaging	Het
Cstf1	T	C	2: 172,377,952	S328P	probably damaging	Het
Cyp2a22	T	C	7: 26,937,780	E193G	possibly damaging	Het
Fam83c	A	G	2: 155,829,287	F743L	probably benign	Het
Fn1	A	G	1: 71,642,905	I364T	probably benign	Het
Foxo3	T	C	10: 42,196,995	M509V	possibly damaging	Het
Galnt6	T	C	15: 100,693,427	T599A	probably benign	Het
Gm5114	A	G	7: 39,411,252	S58P	probably benign	Het
Gria4	G	A	9: 4,480,242	A402V	probably benign	Het
Heatr5a	C	A	12: 51,899,229	A1200S	probably benign	Het
Nlrp5	A	T	7: 23,417,337	D162V	probably benign	Het
Olfr127	T	C	17: 37,904,257	V237A	probably benign	Het
Olfr921	G	A	9: 38,775,281	V9M	noncoding transcript	Het
Pcf11	G	A	7: 92,659,498	R589C	probably damaging	Het
Pkhd1l1	A	G	15: 44,499,300	D574G	probably benign	Het
Plb1	T	C	5: 32,264,906	S68P	probably damaging	Het
Plekhs1	A	G	19: 56,471,756	M95V	probably damaging	Het
Polr2h	T	C	16: 20,717,996		probably null	Het
Ppef2	T	A	5: 92,228,665	I668L	possibly damaging	Het
Rbm46	C	T	3: 82,865,468	R119Q	probably benign	Het
Rwdd1	A	G	10: 34,002,527	V104A	probably damaging	Het
Slc2a9	G	T	5: 38,480,059	H25N	probably benign	Het
Slc36a3	T	A	11: 55,125,081	I416F	probably damaging	Het
Sry	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	Y: 2,662,638		probably benign	Het
Tln1	T	C	4: 43,555,918	T99A	probably damaging	Het
Tm9sf3	A	T	19: 41,240,635	M243K	probably damaging	Het
Trnt1	T	C	6: 106,769,871	Y6H	probably benign	Het
Ttn	T	A	2: 76,782,282	H17151L	probably benign	Het
Ube2o	A	G	11: 116,548,798	V182A	possibly damaging	Het
Zfhx2	G	T	14: 55,072,916	D724E	possibly damaging	Het
Zfp616	T	A	11: 74,085,743	V946D	probably damaging	Het

Other mutations in Sppl2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Sppl2b	APN	10	80864094	missense	probably damaging	1.00
IGL01835:Sppl2b	APN	10	80865341	missense	probably damaging	0.99
IGL01836:Sppl2b	APN	10	80861386	missense	probably benign	0.00
IGL01964:Sppl2b	APN	10	80865386	critical splice donor site	probably null
IGL02376:Sppl2b	APN	10	80867598	nonsense	probably null
R1641:Sppl2b	UTSW	10	80865131	missense	probably damaging	0.96
R2228:Sppl2b	UTSW	10	80865617	missense	probably damaging	1.00
R3104:Sppl2b	UTSW	10	80867491	missense	probably benign	0.00
R3106:Sppl2b	UTSW	10	80867491	missense	probably benign	0.00
R4350:Sppl2b	UTSW	10	80862726	missense	probably benign	0.12
R5146:Sppl2b	UTSW	10	80867640	makesense	probably null
R5698:Sppl2b	UTSW	10	80866045	splice site	probably null
R6969:Sppl2b	UTSW	10	80865125	missense	probably damaging	1.00
R7649:Sppl2b	UTSW	10	80867419	missense	probably benign	0.02
R8263:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8265:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8367:Sppl2b	UTSW	10	80863191	missense	probably benign	0.02
R8398:Sppl2b	UTSW	10	80866068	frame shift	probably null
R8398:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8400:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8480:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8481:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8505:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8817:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8818:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8832:Sppl2b	UTSW	10	80866069	frame shift	probably null
R9175:Sppl2b	UTSW	10	80862973	missense	probably benign
R9624:Sppl2b	UTSW	10	80863539	missense	probably benign	0.03
Z1176:Sppl2b	UTSW	10	80867425	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- GTACATGCTGAAGACCATCCG -3'
(R):5'- AGATGTCTCCAAAGCCCAGG -3'

Sequencing Primer
(F):5'- TGAAGACCATCCGCCTGC -3'
(R):5'- TTCAGCACCATGGGCAG -3'

Posted On

2020-07-13