Incidental Mutation 'R8212:Heatr5a'
ID636221
Institutional Source Beutler Lab
Gene Symbol Heatr5a
Ensembl Gene ENSMUSG00000035181
Gene NameHEAT repeat containing 5A
SynonymsD930036F22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R8212 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location51875871-51971321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 51899229 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 1200 (A1200S)
Ref Sequence ENSEMBL: ENSMUSP00000043115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040583]
Predicted Effect probably benign
Transcript: ENSMUST00000040583
AA Change: A1200S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000043115
Gene: ENSMUSG00000035181
AA Change: A1200S

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
SCOP:d1qbkb_ 112 658 6e-13 SMART
low complexity region 1063 1078 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1110 1120 N/A INTRINSIC
low complexity region 1122 1135 N/A INTRINSIC
low complexity region 1496 1507 N/A INTRINSIC
low complexity region 1722 1735 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,522,121 I2369V probably benign Het
Ager G A 17: 34,600,612 R368H possibly damaging Het
Arl2 G T 19: 6,137,566 T84K probably damaging Het
Cfap126 A T 1: 171,126,061 T67S probably damaging Het
Cfap45 A G 1: 172,541,500 probably null Het
Cfdp1 A T 8: 111,845,183 N31K probably damaging Het
Clpx A G 9: 65,320,891 T408A possibly damaging Het
Cobll1 T C 2: 65,102,080 N526S probably benign Het
Cpne1 T C 2: 156,078,214 D215G probably damaging Het
Cstf1 T C 2: 172,377,952 S328P probably damaging Het
Cyp2a22 T C 7: 26,937,780 E193G possibly damaging Het
Fam83c A G 2: 155,829,287 F743L probably benign Het
Fn1 A G 1: 71,642,905 I364T probably benign Het
Foxo3 T C 10: 42,196,995 M509V possibly damaging Het
Galnt6 T C 15: 100,693,427 T599A probably benign Het
Gm5114 A G 7: 39,411,252 S58P probably benign Het
Gria4 G A 9: 4,480,242 A402V probably benign Het
Nlrp5 A T 7: 23,417,337 D162V probably benign Het
Olfr127 T C 17: 37,904,257 V237A probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pcf11 G A 7: 92,659,498 R589C probably damaging Het
Pkhd1l1 A G 15: 44,499,300 D574G probably benign Het
Plb1 T C 5: 32,264,906 S68P probably damaging Het
Plekhs1 A G 19: 56,471,756 M95V probably damaging Het
Polr2h T C 16: 20,717,996 probably null Het
Ppef2 T A 5: 92,228,665 I668L possibly damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rwdd1 A G 10: 34,002,527 V104A probably damaging Het
Slc2a9 G T 5: 38,480,059 H25N probably benign Het
Slc36a3 T A 11: 55,125,081 I416F probably damaging Het
Sppl2b T A 10: 80,865,359 V356D probably damaging Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Tln1 T C 4: 43,555,918 T99A probably damaging Het
Tm9sf3 A T 19: 41,240,635 M243K probably damaging Het
Trnt1 T C 6: 106,769,871 Y6H probably benign Het
Ttn T A 2: 76,782,282 H17151L probably benign Het
Ube2o A G 11: 116,548,798 V182A possibly damaging Het
Zfhx2 G T 14: 55,072,916 D724E possibly damaging Het
Zfp616 T A 11: 74,085,743 V946D probably damaging Het
Other mutations in Heatr5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Heatr5a APN 12 51888901 missense probably damaging 0.99
IGL01397:Heatr5a APN 12 51894369 missense possibly damaging 0.89
IGL01481:Heatr5a APN 12 51955425 missense probably damaging 1.00
IGL01684:Heatr5a APN 12 51955511 missense probably benign 0.36
IGL01766:Heatr5a APN 12 51889664 missense probably benign 0.15
IGL01799:Heatr5a APN 12 51897835 missense probably benign 0.17
IGL02007:Heatr5a APN 12 51916158 missense probably damaging 1.00
IGL02093:Heatr5a APN 12 51916075 missense possibly damaging 0.68
IGL02205:Heatr5a APN 12 51877337 missense probably damaging 1.00
IGL02450:Heatr5a APN 12 51945430 missense probably benign 0.02
IGL02565:Heatr5a APN 12 51951099 missense possibly damaging 0.54
IGL02707:Heatr5a APN 12 51921366 missense probably benign 0.01
IGL02735:Heatr5a APN 12 51915021 missense probably damaging 0.99
IGL03160:Heatr5a APN 12 51884496 splice site probably benign
F5770:Heatr5a UTSW 12 51881278 splice site probably benign
R0034:Heatr5a UTSW 12 51925172 missense probably damaging 1.00
R0127:Heatr5a UTSW 12 51925405 missense probably benign
R0184:Heatr5a UTSW 12 51909969 missense probably benign 0.00
R0362:Heatr5a UTSW 12 51888861 missense probably damaging 1.00
R0567:Heatr5a UTSW 12 51910089 missense probably damaging 1.00
R0591:Heatr5a UTSW 12 51910101 splice site probably benign
R0736:Heatr5a UTSW 12 51896561 critical splice donor site probably null
R1532:Heatr5a UTSW 12 51952518 missense probably damaging 0.99
R1914:Heatr5a UTSW 12 51905467 missense probably damaging 1.00
R1956:Heatr5a UTSW 12 51945419 critical splice donor site probably null
R1978:Heatr5a UTSW 12 51939658 missense possibly damaging 0.77
R2044:Heatr5a UTSW 12 51955403 missense probably benign 0.19
R2263:Heatr5a UTSW 12 51916150 missense probably damaging 0.97
R2265:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2267:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2268:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2269:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2842:Heatr5a UTSW 12 51955478 missense probably null 1.00
R2842:Heatr5a UTSW 12 51955477 splice site probably null
R3033:Heatr5a UTSW 12 51951038 nonsense probably null
R4303:Heatr5a UTSW 12 51956225 missense probably benign 0.01
R4675:Heatr5a UTSW 12 51877347 missense probably benign 0.17
R4718:Heatr5a UTSW 12 51916163 missense possibly damaging 0.95
R4807:Heatr5a UTSW 12 51877520 missense probably damaging 1.00
R5114:Heatr5a UTSW 12 51956237 nonsense probably null
R5229:Heatr5a UTSW 12 51947978 missense probably benign 0.33
R5411:Heatr5a UTSW 12 51888243 missense probably damaging 1.00
R5548:Heatr5a UTSW 12 51958951 nonsense probably null
R5603:Heatr5a UTSW 12 51877575 missense probably benign 0.26
R5631:Heatr5a UTSW 12 51955527 missense probably benign 0.22
R5742:Heatr5a UTSW 12 51955552 nonsense probably null
R5969:Heatr5a UTSW 12 51959040 missense probably benign
R6020:Heatr5a UTSW 12 51884327 missense probably benign 0.01
R6234:Heatr5a UTSW 12 51877454 missense possibly damaging 0.69
R6352:Heatr5a UTSW 12 51951166 missense possibly damaging 0.88
R6798:Heatr5a UTSW 12 51881265 missense probably benign 0.01
R6815:Heatr5a UTSW 12 51955508 missense possibly damaging 0.89
R7059:Heatr5a UTSW 12 51888234 missense probably damaging 0.98
R7143:Heatr5a UTSW 12 51961468 missense probably benign 0.09
R7178:Heatr5a UTSW 12 51925142 missense probably damaging 0.99
R7291:Heatr5a UTSW 12 51925339 missense probably damaging 0.97
R7454:Heatr5a UTSW 12 51961543 missense probably benign 0.20
R7511:Heatr5a UTSW 12 51879434 missense possibly damaging 0.94
R7636:Heatr5a UTSW 12 51888196 missense probably damaging 1.00
R7636:Heatr5a UTSW 12 51952558 missense probably damaging 1.00
R7665:Heatr5a UTSW 12 51961530 missense probably damaging 1.00
R8088:Heatr5a UTSW 12 51947996 missense possibly damaging 0.85
R8205:Heatr5a UTSW 12 51959009 missense probably benign 0.05
R8213:Heatr5a UTSW 12 51891443 missense probably damaging 0.96
R8323:Heatr5a UTSW 12 51955506 missense probably benign 0.02
R8326:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8339:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8395:Heatr5a UTSW 12 51916178 missense
R8410:Heatr5a UTSW 12 51938120 missense probably benign 0.01
R8676:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8834:Heatr5a UTSW 12 51909956 critical splice donor site probably null
R8916:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
V7732:Heatr5a UTSW 12 51905324 missense possibly damaging 0.65
Z1088:Heatr5a UTSW 12 51891404 missense probably damaging 1.00
Z1088:Heatr5a UTSW 12 51951076 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AACCAGAGGGATAGCTCTCCAC -3'
(R):5'- CCCGTGCTTATGAGTCCTAAC -3'

Sequencing Primer
(F):5'- AGAGGGATAGCTCTCCACTTTTATC -3'
(R):5'- GCTTATGAGTCCTAACTATTTGAGG -3'
Posted On2020-07-13