Incidental Mutation 'R8212:Heatr5a'
ID 636221
Institutional Source Beutler Lab
Gene Symbol Heatr5a
Ensembl Gene ENSMUSG00000035181
Gene Name HEAT repeat containing 5A
Synonyms D930036F22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock # R8212 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 51875871-51971321 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 51899229 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 1200 (A1200S)
Ref Sequence ENSEMBL: ENSMUSP00000043115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040583]
AlphaFold Q5PRF0
Predicted Effect probably benign
Transcript: ENSMUST00000040583
AA Change: A1200S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000043115
Gene: ENSMUSG00000035181
AA Change: A1200S

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
SCOP:d1qbkb_ 112 658 6e-13 SMART
low complexity region 1063 1078 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1110 1120 N/A INTRINSIC
low complexity region 1122 1135 N/A INTRINSIC
low complexity region 1496 1507 N/A INTRINSIC
low complexity region 1722 1735 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,522,121 I2369V probably benign Het
Ager G A 17: 34,600,612 R368H possibly damaging Het
Arl2 G T 19: 6,137,566 T84K probably damaging Het
Cfap126 A T 1: 171,126,061 T67S probably damaging Het
Cfap45 A G 1: 172,541,500 probably null Het
Cfdp1 A T 8: 111,845,183 N31K probably damaging Het
Clpx A G 9: 65,320,891 T408A possibly damaging Het
Cobll1 T C 2: 65,102,080 N526S probably benign Het
Cpne1 T C 2: 156,078,214 D215G probably damaging Het
Cstf1 T C 2: 172,377,952 S328P probably damaging Het
Cyp2a22 T C 7: 26,937,780 E193G possibly damaging Het
Fam83c A G 2: 155,829,287 F743L probably benign Het
Fn1 A G 1: 71,642,905 I364T probably benign Het
Foxo3 T C 10: 42,196,995 M509V possibly damaging Het
Galnt6 T C 15: 100,693,427 T599A probably benign Het
Gm5114 A G 7: 39,411,252 S58P probably benign Het
Gria4 G A 9: 4,480,242 A402V probably benign Het
Nlrp5 A T 7: 23,417,337 D162V probably benign Het
Olfr127 T C 17: 37,904,257 V237A probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pcf11 G A 7: 92,659,498 R589C probably damaging Het
Pkhd1l1 A G 15: 44,499,300 D574G probably benign Het
Plb1 T C 5: 32,264,906 S68P probably damaging Het
Plekhs1 A G 19: 56,471,756 M95V probably damaging Het
Polr2h T C 16: 20,717,996 probably null Het
Ppef2 T A 5: 92,228,665 I668L possibly damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rwdd1 A G 10: 34,002,527 V104A probably damaging Het
Slc2a9 G T 5: 38,480,059 H25N probably benign Het
Slc36a3 T A 11: 55,125,081 I416F probably damaging Het
Sppl2b T A 10: 80,865,359 V356D probably damaging Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Tln1 T C 4: 43,555,918 T99A probably damaging Het
Tm9sf3 A T 19: 41,240,635 M243K probably damaging Het
Trnt1 T C 6: 106,769,871 Y6H probably benign Het
Ttn T A 2: 76,782,282 H17151L probably benign Het
Ube2o A G 11: 116,548,798 V182A possibly damaging Het
Zfhx2 G T 14: 55,072,916 D724E possibly damaging Het
Zfp616 T A 11: 74,085,743 V946D probably damaging Het
Other mutations in Heatr5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Heatr5a APN 12 51888901 missense probably damaging 0.99
IGL01397:Heatr5a APN 12 51894369 missense possibly damaging 0.89
IGL01481:Heatr5a APN 12 51955425 missense probably damaging 1.00
IGL01684:Heatr5a APN 12 51955511 missense probably benign 0.36
IGL01766:Heatr5a APN 12 51889664 missense probably benign 0.15
IGL01799:Heatr5a APN 12 51897835 missense probably benign 0.17
IGL02007:Heatr5a APN 12 51916158 missense probably damaging 1.00
IGL02093:Heatr5a APN 12 51916075 missense possibly damaging 0.68
IGL02205:Heatr5a APN 12 51877337 missense probably damaging 1.00
IGL02450:Heatr5a APN 12 51945430 missense probably benign 0.02
IGL02565:Heatr5a APN 12 51951099 missense possibly damaging 0.54
IGL02707:Heatr5a APN 12 51921366 missense probably benign 0.01
IGL02735:Heatr5a APN 12 51915021 missense probably damaging 0.99
IGL03160:Heatr5a APN 12 51884496 splice site probably benign
F5770:Heatr5a UTSW 12 51881278 splice site probably benign
R0034:Heatr5a UTSW 12 51925172 missense probably damaging 1.00
R0127:Heatr5a UTSW 12 51925405 missense probably benign
R0184:Heatr5a UTSW 12 51909969 missense probably benign 0.00
R0362:Heatr5a UTSW 12 51888861 missense probably damaging 1.00
R0567:Heatr5a UTSW 12 51910089 missense probably damaging 1.00
R0591:Heatr5a UTSW 12 51910101 splice site probably benign
R0736:Heatr5a UTSW 12 51896561 critical splice donor site probably null
R1532:Heatr5a UTSW 12 51952518 missense probably damaging 0.99
R1914:Heatr5a UTSW 12 51905467 missense probably damaging 1.00
R1956:Heatr5a UTSW 12 51945419 critical splice donor site probably null
R1978:Heatr5a UTSW 12 51939658 missense possibly damaging 0.77
R2044:Heatr5a UTSW 12 51955403 missense probably benign 0.19
R2263:Heatr5a UTSW 12 51916150 missense probably damaging 0.97
R2265:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2267:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2268:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2269:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2842:Heatr5a UTSW 12 51955478 missense probably null 1.00
R2842:Heatr5a UTSW 12 51955477 splice site probably null
R3033:Heatr5a UTSW 12 51951038 nonsense probably null
R4303:Heatr5a UTSW 12 51956225 missense probably benign 0.01
R4675:Heatr5a UTSW 12 51877347 missense probably benign 0.17
R4718:Heatr5a UTSW 12 51916163 missense possibly damaging 0.95
R4807:Heatr5a UTSW 12 51877520 missense probably damaging 1.00
R5114:Heatr5a UTSW 12 51956237 nonsense probably null
R5229:Heatr5a UTSW 12 51947978 missense probably benign 0.33
R5411:Heatr5a UTSW 12 51888243 missense probably damaging 1.00
R5548:Heatr5a UTSW 12 51958951 nonsense probably null
R5603:Heatr5a UTSW 12 51877575 missense probably benign 0.26
R5631:Heatr5a UTSW 12 51955527 missense probably benign 0.22
R5742:Heatr5a UTSW 12 51955552 nonsense probably null
R5969:Heatr5a UTSW 12 51959040 missense probably benign
R6020:Heatr5a UTSW 12 51884327 missense probably benign 0.01
R6234:Heatr5a UTSW 12 51877454 missense possibly damaging 0.69
R6352:Heatr5a UTSW 12 51951166 missense possibly damaging 0.88
R6798:Heatr5a UTSW 12 51881265 missense probably benign 0.01
R6815:Heatr5a UTSW 12 51955508 missense possibly damaging 0.89
R7059:Heatr5a UTSW 12 51888234 missense probably damaging 0.98
R7143:Heatr5a UTSW 12 51961468 missense probably benign 0.09
R7178:Heatr5a UTSW 12 51925142 missense probably damaging 0.99
R7291:Heatr5a UTSW 12 51925339 missense probably damaging 0.97
R7454:Heatr5a UTSW 12 51961543 missense probably benign 0.20
R7511:Heatr5a UTSW 12 51879434 missense possibly damaging 0.94
R7636:Heatr5a UTSW 12 51888196 missense probably damaging 1.00
R7636:Heatr5a UTSW 12 51952558 missense probably damaging 1.00
R7665:Heatr5a UTSW 12 51961530 missense probably damaging 1.00
R8088:Heatr5a UTSW 12 51947996 missense possibly damaging 0.85
R8205:Heatr5a UTSW 12 51959009 missense probably benign 0.05
R8213:Heatr5a UTSW 12 51891443 missense probably damaging 0.96
R8323:Heatr5a UTSW 12 51955506 missense probably benign 0.02
R8326:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8339:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8395:Heatr5a UTSW 12 51916178 missense
R8410:Heatr5a UTSW 12 51938120 missense probably benign 0.01
R8676:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8834:Heatr5a UTSW 12 51909956 critical splice donor site probably null
R8916:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R9057:Heatr5a UTSW 12 51939637 missense probably damaging 1.00
R9248:Heatr5a UTSW 12 51916243 missense
R9287:Heatr5a UTSW 12 51920477 missense probably damaging 0.97
R9332:Heatr5a UTSW 12 51899285 missense probably benign 0.33
R9454:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R9515:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R9654:Heatr5a UTSW 12 51958995 missense probably damaging 1.00
V7732:Heatr5a UTSW 12 51905324 missense possibly damaging 0.65
Z1088:Heatr5a UTSW 12 51891404 missense probably damaging 1.00
Z1088:Heatr5a UTSW 12 51951076 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AACCAGAGGGATAGCTCTCCAC -3'
(R):5'- CCCGTGCTTATGAGTCCTAAC -3'

Sequencing Primer
(F):5'- AGAGGGATAGCTCTCCACTTTTATC -3'
(R):5'- GCTTATGAGTCCTAACTATTTGAGG -3'
Posted On 2020-07-13