Mutagenetix > Incidental Mutations

Incidental Mutation 'R8212:Heatr5a'

636221

Institutional Source

Beutler Lab

Gene Symbol

Heatr5a

Ensembl Gene

ENSMUSG00000035181

Gene Name

HEAT repeat containing 5A

Synonyms

D930036F22Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.263) question?

Stock #

R8212 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

51875871-51971321 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 51899229 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 1200 (A1200S)

Ref Sequence

ENSEMBL: ENSMUSP00000043115 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040583]

Predicted Effect

probably benign
Transcript: ENSMUST00000040583
AA Change: A1200S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000043115
Gene: ENSMUSG00000035181
AA Change: A1200S

Domain	Start	End	E-Value	Type
low complexity region	56	67	N/A	INTRINSIC
SCOP:d1qbkb_	112	658	6e-13	SMART
low complexity region	1063	1078	N/A	INTRINSIC
low complexity region	1081	1095	N/A	INTRINSIC
low complexity region	1110	1120	N/A	INTRINSIC
low complexity region	1122	1135	N/A	INTRINSIC
low complexity region	1496	1507	N/A	INTRINSIC
low complexity region	1722	1735	N/A	INTRINSIC
low complexity region	1925	1936	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

97% (37/38)

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	T	C	13: 81,522,121	I2369V	probably benign	Het
Ager	G	A	17: 34,600,612	R368H	possibly damaging	Het
Arl2	G	T	19: 6,137,566	T84K	probably damaging	Het
Cfap126	A	T	1: 171,126,061	T67S	probably damaging	Het
Cfap45	A	G	1: 172,541,500		probably null	Het
Cfdp1	A	T	8: 111,845,183	N31K	probably damaging	Het
Clpx	A	G	9: 65,320,891	T408A	possibly damaging	Het
Cobll1	T	C	2: 65,102,080	N526S	probably benign	Het
Cpne1	T	C	2: 156,078,214	D215G	probably damaging	Het
Cstf1	T	C	2: 172,377,952	S328P	probably damaging	Het
Cyp2a22	T	C	7: 26,937,780	E193G	possibly damaging	Het
Fam83c	A	G	2: 155,829,287	F743L	probably benign	Het
Fn1	A	G	1: 71,642,905	I364T	probably benign	Het
Foxo3	T	C	10: 42,196,995	M509V	possibly damaging	Het
Galnt6	T	C	15: 100,693,427	T599A	probably benign	Het
Gm5114	A	G	7: 39,411,252	S58P	probably benign	Het
Gria4	G	A	9: 4,480,242	A402V	probably benign	Het
Nlrp5	A	T	7: 23,417,337	D162V	probably benign	Het
Olfr127	T	C	17: 37,904,257	V237A	probably benign	Het
Olfr921	G	A	9: 38,775,281	V9M	noncoding transcript	Het
Pcf11	G	A	7: 92,659,498	R589C	probably damaging	Het
Pkhd1l1	A	G	15: 44,499,300	D574G	probably benign	Het
Plb1	T	C	5: 32,264,906	S68P	probably damaging	Het
Plekhs1	A	G	19: 56,471,756	M95V	probably damaging	Het
Polr2h	T	C	16: 20,717,996		probably null	Het
Ppef2	T	A	5: 92,228,665	I668L	possibly damaging	Het
Rbm46	C	T	3: 82,865,468	R119Q	probably benign	Het
Rwdd1	A	G	10: 34,002,527	V104A	probably damaging	Het
Slc2a9	G	T	5: 38,480,059	H25N	probably benign	Het
Slc36a3	T	A	11: 55,125,081	I416F	probably damaging	Het
Sppl2b	T	A	10: 80,865,359	V356D	probably damaging	Het
Sry	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	Y: 2,662,638		probably benign	Het
Tln1	T	C	4: 43,555,918	T99A	probably damaging	Het
Tm9sf3	A	T	19: 41,240,635	M243K	probably damaging	Het
Trnt1	T	C	6: 106,769,871	Y6H	probably benign	Het
Ttn	T	A	2: 76,782,282	H17151L	probably benign	Het
Ube2o	A	G	11: 116,548,798	V182A	possibly damaging	Het
Zfhx2	G	T	14: 55,072,916	D724E	possibly damaging	Het
Zfp616	T	A	11: 74,085,743	V946D	probably damaging	Het

Other mutations in Heatr5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Heatr5a	APN	12	51888901	missense	probably damaging	0.99
IGL01397:Heatr5a	APN	12	51894369	missense	possibly damaging	0.89
IGL01481:Heatr5a	APN	12	51955425	missense	probably damaging	1.00
IGL01684:Heatr5a	APN	12	51955511	missense	probably benign	0.36
IGL01766:Heatr5a	APN	12	51889664	missense	probably benign	0.15
IGL01799:Heatr5a	APN	12	51897835	missense	probably benign	0.17
IGL02007:Heatr5a	APN	12	51916158	missense	probably damaging	1.00
IGL02093:Heatr5a	APN	12	51916075	missense	possibly damaging	0.68
IGL02205:Heatr5a	APN	12	51877337	missense	probably damaging	1.00
IGL02450:Heatr5a	APN	12	51945430	missense	probably benign	0.02
IGL02565:Heatr5a	APN	12	51951099	missense	possibly damaging	0.54
IGL02707:Heatr5a	APN	12	51921366	missense	probably benign	0.01
IGL02735:Heatr5a	APN	12	51915021	missense	probably damaging	0.99
IGL03160:Heatr5a	APN	12	51884496	splice site	probably benign
F5770:Heatr5a	UTSW	12	51881278	splice site	probably benign
R0034:Heatr5a	UTSW	12	51925172	missense	probably damaging	1.00
R0127:Heatr5a	UTSW	12	51925405	missense	probably benign
R0184:Heatr5a	UTSW	12	51909969	missense	probably benign	0.00
R0362:Heatr5a	UTSW	12	51888861	missense	probably damaging	1.00
R0567:Heatr5a	UTSW	12	51910089	missense	probably damaging	1.00
R0591:Heatr5a	UTSW	12	51910101	splice site	probably benign
R0736:Heatr5a	UTSW	12	51896561	critical splice donor site	probably null
R1532:Heatr5a	UTSW	12	51952518	missense	probably damaging	0.99
R1914:Heatr5a	UTSW	12	51905467	missense	probably damaging	1.00
R1956:Heatr5a	UTSW	12	51945419	critical splice donor site	probably null
R1978:Heatr5a	UTSW	12	51939658	missense	possibly damaging	0.77
R2044:Heatr5a	UTSW	12	51955403	missense	probably benign	0.19
R2263:Heatr5a	UTSW	12	51916150	missense	probably damaging	0.97
R2265:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2267:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2268:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2269:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2842:Heatr5a	UTSW	12	51955478	missense	probably null	1.00
R2842:Heatr5a	UTSW	12	51955477	splice site	probably null
R3033:Heatr5a	UTSW	12	51951038	nonsense	probably null
R4303:Heatr5a	UTSW	12	51956225	missense	probably benign	0.01
R4675:Heatr5a	UTSW	12	51877347	missense	probably benign	0.17
R4718:Heatr5a	UTSW	12	51916163	missense	possibly damaging	0.95
R4807:Heatr5a	UTSW	12	51877520	missense	probably damaging	1.00
R5114:Heatr5a	UTSW	12	51956237	nonsense	probably null
R5229:Heatr5a	UTSW	12	51947978	missense	probably benign	0.33
R5411:Heatr5a	UTSW	12	51888243	missense	probably damaging	1.00
R5548:Heatr5a	UTSW	12	51958951	nonsense	probably null
R5603:Heatr5a	UTSW	12	51877575	missense	probably benign	0.26
R5631:Heatr5a	UTSW	12	51955527	missense	probably benign	0.22
R5742:Heatr5a	UTSW	12	51955552	nonsense	probably null
R5969:Heatr5a	UTSW	12	51959040	missense	probably benign
R6020:Heatr5a	UTSW	12	51884327	missense	probably benign	0.01
R6234:Heatr5a	UTSW	12	51877454	missense	possibly damaging	0.69
R6352:Heatr5a	UTSW	12	51951166	missense	possibly damaging	0.88
R6798:Heatr5a	UTSW	12	51881265	missense	probably benign	0.01
R6815:Heatr5a	UTSW	12	51955508	missense	possibly damaging	0.89
R7059:Heatr5a	UTSW	12	51888234	missense	probably damaging	0.98
R7143:Heatr5a	UTSW	12	51961468	missense	probably benign	0.09
R7178:Heatr5a	UTSW	12	51925142	missense	probably damaging	0.99
R7291:Heatr5a	UTSW	12	51925339	missense	probably damaging	0.97
R7454:Heatr5a	UTSW	12	51961543	missense	probably benign	0.20
R7511:Heatr5a	UTSW	12	51879434	missense	possibly damaging	0.94
R7636:Heatr5a	UTSW	12	51888196	missense	probably damaging	1.00
R7636:Heatr5a	UTSW	12	51952558	missense	probably damaging	1.00
R7665:Heatr5a	UTSW	12	51961530	missense	probably damaging	1.00
R8088:Heatr5a	UTSW	12	51947996	missense	possibly damaging	0.85
R8205:Heatr5a	UTSW	12	51959009	missense	probably benign	0.05
R8213:Heatr5a	UTSW	12	51891443	missense	probably damaging	0.96
R8323:Heatr5a	UTSW	12	51955506	missense	probably benign	0.02
R8326:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R8339:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R8395:Heatr5a	UTSW	12	51916178	missense
R8410:Heatr5a	UTSW	12	51938120	missense	probably benign	0.01
R8676:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R8834:Heatr5a	UTSW	12	51909956	critical splice donor site	probably null
R8916:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
V7732:Heatr5a	UTSW	12	51905324	missense	possibly damaging	0.65
Z1088:Heatr5a	UTSW	12	51891404	missense	probably damaging	1.00
Z1088:Heatr5a	UTSW	12	51951076	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- AACCAGAGGGATAGCTCTCCAC -3'
(R):5'- CCCGTGCTTATGAGTCCTAAC -3'

Sequencing Primer
(F):5'- AGAGGGATAGCTCTCCACTTTTATC -3'
(R):5'- GCTTATGAGTCCTAACTATTTGAGG -3'

Posted On

2020-07-13