Incidental Mutation 'R8213:Syt14'
ID636235
Institutional Source Beutler Lab
Gene Symbol Syt14
Ensembl Gene ENSMUSG00000016200
Gene Namesynaptotagmin XIV
SynonymsB230320I09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8213 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location192891233-193035775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 192986829 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 39 (M39V)
Ref Sequence ENSEMBL: ENSMUSP00000016344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016344] [ENSMUST00000195354] [ENSMUST00000195530]
Predicted Effect probably benign
Transcript: ENSMUST00000016344
AA Change: M39V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000016344
Gene: ENSMUSG00000016200
AA Change: M39V

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
C2 276 378 1.41e0 SMART
C2 431 547 1.38e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195354
AA Change: M39V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000142190
Gene: ENSMUSG00000016200
AA Change: M39V

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
C2 276 378 1.41e0 SMART
C2 431 547 1.38e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000195530
AA Change: M39V

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141563
Gene: ENSMUSG00000016200
AA Change: M39V

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: This gene encodes a member of the synaptotagmin family. The encoded protein may be involved in membrane trafficking. Disruption of a similar gene in human has been associated with autosomal recessive spinocerebellar ataxia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,756 Y277C probably damaging Het
Acss1 T A 2: 150,619,710 D651V possibly damaging Het
Aktip G T 8: 91,124,866 P243H possibly damaging Het
Arl11 T G 14: 61,311,265 S175A probably benign Het
Aup1 A G 6: 83,054,607 probably benign Het
Avil A T 10: 127,008,321 I250F probably damaging Het
Btnl6 A T 17: 34,508,883 probably null Het
C77080 A T 4: 129,221,459 V1070D possibly damaging Het
Ccdc7b C A 8: 129,178,291 Q137K probably benign Het
Cdk11b G A 4: 155,639,881 E319K unknown Het
Chka A C 19: 3,885,882 E196A probably damaging Het
Depdc5 C T 5: 32,937,637 R753C probably damaging Het
Dhx57 T A 17: 80,275,156 D340V possibly damaging Het
Dicer1 A T 12: 104,702,693 D1243E probably benign Het
Dnajb9 A T 12: 44,207,133 L164M probably benign Het
Dock6 A G 9: 21,831,444 V785A possibly damaging Het
Efcab5 T C 11: 77,116,071 Y909C probably damaging Het
Erp44 A T 4: 48,208,783 S226T probably benign Het
Fgd6 A T 10: 94,044,052 D256V probably benign Het
Fhl5 A T 4: 25,207,113 Y218* probably null Het
Filip1 C A 9: 79,818,092 A1082S probably benign Het
Gm13088 T A 4: 143,654,185 M423L probably benign Het
Gm13128 A T 4: 144,330,460 D71V probably benign Het
Heatr5a G A 12: 51,891,443 T1484M probably damaging Het
Herc1 G T 9: 66,450,888 R2417L probably damaging Het
Hnrnpr A G 4: 136,317,175 probably benign Het
Igsf5 A T 16: 96,372,988 I73F probably damaging Het
Il17ra T C 6: 120,473,034 V91A probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 K548E probably damaging Het
Kdm5d T A Y: 941,515 C1239S probably damaging Het
Mamdc4 G A 2: 25,566,356 T709M probably benign Het
Mybbp1a T A 11: 72,444,721 Y353N probably damaging Het
Nepn A T 10: 52,391,759 E40D probably benign Het
Npat G T 9: 53,570,570 E1193* probably null Het
Nrde2 G A 12: 100,131,003 S846L probably benign Het
Nup205 T C 6: 35,225,203 V1290A probably benign Het
Olfr1009 T A 2: 85,721,501 L32Q probably null Het
Olfr1424 A G 19: 12,059,092 V220A probably benign Het
Olfr517 C A 7: 108,868,519 V212L probably benign Het
Pde6a A T 18: 61,220,696 K31M possibly damaging Het
Pms2 C T 5: 143,914,771 R169C probably damaging Het
Polr2g A T 19: 8,798,257 L30Q probably damaging Het
Prdm15 T A 16: 97,807,060 H679L probably damaging Het
Prl4a1 T G 13: 28,023,386 Y214* probably null Het
Prlr C T 15: 10,329,242 T601M possibly damaging Het
Psen2 A C 1: 180,245,691 S22A probably benign Het
Ralgapa1 C A 12: 55,722,914 R764L probably damaging Het
Scgb2b11 T C 7: 32,209,408 E89G probably damaging Het
Serpina10 T C 12: 103,628,277 I228V probably benign Het
Serpinb1a T A 13: 32,842,999 H320L probably damaging Het
Sesn2 C A 4: 132,498,053 Q267H possibly damaging Het
Sgsm1 A T 5: 113,251,011 W1019R probably damaging Het
Sqle A G 15: 59,321,302 probably null Het
Tgm7 A G 2: 121,101,064 V206A probably damaging Het
Thbs4 T C 13: 92,760,586 probably null Het
Trpv1 T C 11: 73,254,251 F721S probably damaging Het
Ttll10 A T 4: 156,036,234 M433K probably benign Het
Vmn1r216 T C 13: 23,099,525 I126T probably benign Het
Vmn2r108 G A 17: 20,470,088 S494F probably benign Het
Vwa3b C T 1: 37,128,939 A603V probably benign Het
Xirp2 T A 2: 67,476,866 N19K probably damaging Het
Zfp397 T A 18: 23,960,722 N421K probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Syt14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Syt14 APN 1 192930484 missense possibly damaging 0.88
IGL01535:Syt14 APN 1 192986765 missense probably damaging 1.00
IGL01935:Syt14 APN 1 192933371 missense probably damaging 0.99
IGL02531:Syt14 APN 1 192901934 makesense probably null
IGL02716:Syt14 APN 1 192980535 missense possibly damaging 0.92
IGL03051:Syt14 APN 1 192933220 missense probably benign 0.19
IGL03268:Syt14 APN 1 192986834 missense probably benign 0.25
crumpled UTSW 1 192901869 missense possibly damaging 0.82
R0542:Syt14 UTSW 1 192930803 missense probably damaging 1.00
R0598:Syt14 UTSW 1 192897314 missense probably damaging 1.00
R1533:Syt14 UTSW 1 192930776 missense possibly damaging 0.94
R1675:Syt14 UTSW 1 192897482 missense probably damaging 1.00
R1907:Syt14 UTSW 1 192901835 missense probably damaging 1.00
R3032:Syt14 UTSW 1 192986751 missense possibly damaging 0.86
R3828:Syt14 UTSW 1 192901775 missense probably damaging 1.00
R3965:Syt14 UTSW 1 192901867 missense probably benign 0.04
R4646:Syt14 UTSW 1 192933325 missense probably damaging 1.00
R4730:Syt14 UTSW 1 192930786 missense probably damaging 1.00
R4909:Syt14 UTSW 1 192898859 missense probably damaging 1.00
R4970:Syt14 UTSW 1 192930977 intron probably benign
R5039:Syt14 UTSW 1 193026984 missense probably damaging 1.00
R5363:Syt14 UTSW 1 192930663 missense possibly damaging 0.94
R5593:Syt14 UTSW 1 192930923 missense probably damaging 1.00
R5980:Syt14 UTSW 1 192980408 missense possibly damaging 0.89
R6014:Syt14 UTSW 1 192930695 missense probably damaging 0.99
R6221:Syt14 UTSW 1 192930600 missense probably damaging 1.00
R6547:Syt14 UTSW 1 192901869 missense possibly damaging 0.82
R6804:Syt14 UTSW 1 192901853 missense probably damaging 1.00
R7038:Syt14 UTSW 1 192983658 intron probably benign
R7179:Syt14 UTSW 1 192933263 missense probably damaging 1.00
R7196:Syt14 UTSW 1 193035628 missense probably benign 0.01
R7311:Syt14 UTSW 1 192980550 missense probably benign
R7577:Syt14 UTSW 1 192983577 missense unknown
R7769:Syt14 UTSW 1 192984324 missense unknown
R7779:Syt14 UTSW 1 192984443 missense unknown
Z1176:Syt14 UTSW 1 192933198 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCAGGCTATTTCTCTTAATGCAGTATC -3'
(R):5'- CACTTTGTGGGGTTTCTTACAAAC -3'

Sequencing Primer
(F):5'- AAAGTTGGCCTTCTCATAGCAC -3'
(R):5'- GCGTATACTGGGAAATTCCT -3'
Posted On2020-07-13