Incidental Mutation 'R8213:Mamdc4'
ID 636236
Institutional Source Beutler Lab
Gene Symbol Mamdc4
Ensembl Gene ENSMUSG00000026941
Gene Name MAM domain containing 4
Synonyms LOC381352
MMRRC Submission 067655-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R8213 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 25453124-25461328 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 25456368 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 709 (T709M)
Ref Sequence ENSEMBL: ENSMUSP00000092735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015236] [ENSMUST00000095117] [ENSMUST00000114223]
AlphaFold A2AJA7
Predicted Effect probably benign
Transcript: ENSMUST00000015236
SMART Domains Protein: ENSMUSP00000015236
Gene: ENSMUSG00000015092

DomainStartEndE-ValueType
Pfam:MBF1 4 73 4.6e-29 PFAM
HTH_XRE 80 135 1.02e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095117
AA Change: T709M

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000092735
Gene: ENSMUSG00000026941
AA Change: T709M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LDLa 32 58 7.33e-1 SMART
MAM 66 227 3.56e-52 SMART
LDLa 233 272 3.5e-9 SMART
MAM 254 430 3.87e-53 SMART
LDLa 461 497 2.63e-4 SMART
MAM 493 653 5.33e-5 SMART
MAM 660 819 3.68e-68 SMART
MAM 820 979 1.07e-28 SMART
MAM 980 1148 2.07e-62 SMART
transmembrane domain 1165 1187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114223
AA Change: T705M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109861
Gene: ENSMUSG00000026941
AA Change: T705M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 28 54 7.33e-1 SMART
MAM 62 223 3.56e-52 SMART
LDLa 229 268 3.5e-9 SMART
MAM 250 426 3.87e-53 SMART
LDLa 457 493 2.63e-4 SMART
MAM 489 649 5.33e-5 SMART
MAM 656 815 3.68e-68 SMART
MAM 816 975 1.07e-28 SMART
MAM 976 1144 2.07e-62 SMART
transmembrane domain 1161 1183 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000119789
Gene: ENSMUSG00000026941
AA Change: T606M

DomainStartEndE-ValueType
LDLa 9 35 7.33e-1 SMART
MAM 43 204 3.56e-52 SMART
LDLa 210 249 3.5e-9 SMART
MAM 231 407 3.87e-53 SMART
LDLa 438 474 2.63e-4 SMART
MAM 558 717 2.27e-68 SMART
MAM 718 877 1.07e-28 SMART
MAM 878 1046 2.07e-62 SMART
transmembrane domain 1063 1085 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,791,605 (GRCm39) Y277C probably damaging Het
Acss1 T A 2: 150,461,630 (GRCm39) D651V possibly damaging Het
Aktip G T 8: 91,851,494 (GRCm39) P243H possibly damaging Het
Arl11 T G 14: 61,548,714 (GRCm39) S175A probably benign Het
Aup1 A G 6: 83,031,588 (GRCm39) probably benign Het
Avil A T 10: 126,844,190 (GRCm39) I250F probably damaging Het
Btnl6 A T 17: 34,727,857 (GRCm39) probably null Het
Ccdc7b C A 8: 129,904,772 (GRCm39) Q137K probably benign Het
Cdk11b G A 4: 155,724,338 (GRCm39) E319K unknown Het
Chka A C 19: 3,935,882 (GRCm39) E196A probably damaging Het
Depdc5 C T 5: 33,094,981 (GRCm39) R753C probably damaging Het
Dhx57 T A 17: 80,582,585 (GRCm39) D340V possibly damaging Het
Dicer1 A T 12: 104,668,952 (GRCm39) D1243E probably benign Het
Dnajb9 A T 12: 44,253,916 (GRCm39) L164M probably benign Het
Dock6 A G 9: 21,742,740 (GRCm39) V785A possibly damaging Het
Efcab5 T C 11: 77,006,897 (GRCm39) Y909C probably damaging Het
Erp44 A T 4: 48,208,783 (GRCm39) S226T probably benign Het
Fgd6 A T 10: 93,879,914 (GRCm39) D256V probably benign Het
Fhl5 A T 4: 25,207,113 (GRCm39) Y218* probably null Het
Filip1 C A 9: 79,725,374 (GRCm39) A1082S probably benign Het
Heatr5a G A 12: 51,938,226 (GRCm39) T1484M probably damaging Het
Herc1 G T 9: 66,358,170 (GRCm39) R2417L probably damaging Het
Hnrnpr A G 4: 136,044,486 (GRCm39) probably benign Het
Igsf5 A T 16: 96,174,188 (GRCm39) I73F probably damaging Het
Il17ra T C 6: 120,449,995 (GRCm39) V91A probably benign Het
Inpp5f A G 7: 128,281,529 (GRCm39) D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 (GRCm39) K548E probably damaging Het
Kdm5d T A Y: 941,515 (GRCm39) C1239S probably damaging Het
Mybbp1a T A 11: 72,335,547 (GRCm39) Y353N probably damaging Het
Nepn A T 10: 52,267,855 (GRCm39) E40D probably benign Het
Nhsl3 A T 4: 129,115,252 (GRCm39) V1070D possibly damaging Het
Npat G T 9: 53,481,870 (GRCm39) E1193* probably null Het
Nrde2 G A 12: 100,097,262 (GRCm39) S846L probably benign Het
Nup205 T C 6: 35,202,138 (GRCm39) V1290A probably benign Het
Or10a49 C A 7: 108,467,726 (GRCm39) V212L probably benign Het
Or4d10b A G 19: 12,036,456 (GRCm39) V220A probably benign Het
Or5g9 T A 2: 85,551,845 (GRCm39) L32Q probably null Het
Pde6a A T 18: 61,353,768 (GRCm39) K31M possibly damaging Het
Pms2 C T 5: 143,851,589 (GRCm39) R169C probably damaging Het
Polr2g A T 19: 8,775,621 (GRCm39) L30Q probably damaging Het
Pramel22 T A 4: 143,380,755 (GRCm39) M423L probably benign Het
Pramel30 A T 4: 144,057,030 (GRCm39) D71V probably benign Het
Prdm15 T A 16: 97,608,260 (GRCm39) H679L probably damaging Het
Prl4a1 T G 13: 28,207,369 (GRCm39) Y214* probably null Het
Prlr C T 15: 10,329,328 (GRCm39) T601M possibly damaging Het
Psen2 A C 1: 180,073,256 (GRCm39) S22A probably benign Het
Ralgapa1 C A 12: 55,769,699 (GRCm39) R764L probably damaging Het
Scgb2b11 T C 7: 31,908,833 (GRCm39) E89G probably damaging Het
Serpina10 T C 12: 103,594,536 (GRCm39) I228V probably benign Het
Serpinb1a T A 13: 33,026,982 (GRCm39) H320L probably damaging Het
Sesn2 C A 4: 132,225,364 (GRCm39) Q267H possibly damaging Het
Sgsm1 A T 5: 113,398,877 (GRCm39) W1019R probably damaging Het
Sqle A G 15: 59,193,151 (GRCm39) probably null Het
Syt14 T C 1: 192,669,137 (GRCm39) M39V probably benign Het
Tgm7 A G 2: 120,931,545 (GRCm39) V206A probably damaging Het
Thbs4 T C 13: 92,897,094 (GRCm39) probably null Het
Trpv1 T C 11: 73,145,077 (GRCm39) F721S probably damaging Het
Ttll10 A T 4: 156,120,691 (GRCm39) M433K probably benign Het
Vmn1r216 T C 13: 23,283,695 (GRCm39) I126T probably benign Het
Vmn2r108 G A 17: 20,690,350 (GRCm39) S494F probably benign Het
Vwa3b C T 1: 37,168,020 (GRCm39) A603V probably benign Het
Xirp2 T A 2: 67,307,210 (GRCm39) N19K probably damaging Het
Zfp397 T A 18: 24,093,779 (GRCm39) N421K probably damaging Het
Zscan5b C T 7: 6,236,946 (GRCm39) P232S possibly damaging Het
Other mutations in Mamdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Mamdc4 APN 2 25,453,588 (GRCm39) missense possibly damaging 0.53
IGL01994:Mamdc4 APN 2 25,458,546 (GRCm39) missense possibly damaging 0.64
IGL02072:Mamdc4 APN 2 25,458,351 (GRCm39) missense probably damaging 1.00
IGL02193:Mamdc4 APN 2 25,454,458 (GRCm39) missense probably benign 0.02
IGL02673:Mamdc4 APN 2 25,460,066 (GRCm39) missense probably benign
IGL03048:Mamdc4 UTSW 2 25,459,084 (GRCm39) missense possibly damaging 0.67
R0135:Mamdc4 UTSW 2 25,456,932 (GRCm39) missense possibly damaging 0.71
R0481:Mamdc4 UTSW 2 25,461,228 (GRCm39) start codon destroyed probably null 0.08
R0490:Mamdc4 UTSW 2 25,453,593 (GRCm39) missense probably benign 0.01
R0609:Mamdc4 UTSW 2 25,454,205 (GRCm39) missense probably benign 0.30
R0729:Mamdc4 UTSW 2 25,460,048 (GRCm39) missense probably damaging 0.98
R1365:Mamdc4 UTSW 2 25,456,036 (GRCm39) missense probably damaging 1.00
R1533:Mamdc4 UTSW 2 25,459,759 (GRCm39) missense possibly damaging 0.71
R1671:Mamdc4 UTSW 2 25,458,235 (GRCm39) nonsense probably null
R1789:Mamdc4 UTSW 2 25,457,634 (GRCm39) missense possibly damaging 0.59
R2002:Mamdc4 UTSW 2 25,457,244 (GRCm39) missense probably damaging 1.00
R2013:Mamdc4 UTSW 2 25,453,584 (GRCm39) missense probably damaging 0.98
R2014:Mamdc4 UTSW 2 25,453,584 (GRCm39) missense probably damaging 0.98
R2056:Mamdc4 UTSW 2 25,454,180 (GRCm39) missense probably benign 0.18
R2109:Mamdc4 UTSW 2 25,459,402 (GRCm39) missense probably damaging 1.00
R2128:Mamdc4 UTSW 2 25,459,270 (GRCm39) missense probably damaging 1.00
R2185:Mamdc4 UTSW 2 25,459,704 (GRCm39) critical splice donor site probably null
R2473:Mamdc4 UTSW 2 25,456,344 (GRCm39) missense probably damaging 0.99
R2496:Mamdc4 UTSW 2 25,455,914 (GRCm39) missense probably damaging 1.00
R3818:Mamdc4 UTSW 2 25,455,785 (GRCm39) missense probably benign
R4591:Mamdc4 UTSW 2 25,454,609 (GRCm39) missense possibly damaging 0.87
R4829:Mamdc4 UTSW 2 25,455,368 (GRCm39) missense possibly damaging 0.85
R4898:Mamdc4 UTSW 2 25,460,035 (GRCm39) missense probably damaging 0.98
R5209:Mamdc4 UTSW 2 25,456,935 (GRCm39) missense probably damaging 0.97
R5268:Mamdc4 UTSW 2 25,454,702 (GRCm39) missense possibly damaging 0.95
R5490:Mamdc4 UTSW 2 25,455,890 (GRCm39) missense probably damaging 1.00
R6152:Mamdc4 UTSW 2 25,457,451 (GRCm39) missense probably damaging 1.00
R6234:Mamdc4 UTSW 2 25,460,092 (GRCm39) missense probably damaging 1.00
R6681:Mamdc4 UTSW 2 25,457,756 (GRCm39) missense probably damaging 1.00
R6774:Mamdc4 UTSW 2 25,456,948 (GRCm39) missense probably benign 0.06
R7178:Mamdc4 UTSW 2 25,458,977 (GRCm39) missense probably benign 0.04
R7225:Mamdc4 UTSW 2 25,455,558 (GRCm39) missense possibly damaging 0.50
R7451:Mamdc4 UTSW 2 25,454,473 (GRCm39) missense possibly damaging 0.80
R7520:Mamdc4 UTSW 2 25,455,360 (GRCm39) missense possibly damaging 0.88
R7627:Mamdc4 UTSW 2 25,458,225 (GRCm39) missense probably damaging 1.00
R7875:Mamdc4 UTSW 2 25,458,677 (GRCm39) nonsense probably null
R8041:Mamdc4 UTSW 2 25,454,707 (GRCm39) missense probably damaging 1.00
R8144:Mamdc4 UTSW 2 25,457,019 (GRCm39) missense probably damaging 0.99
R8201:Mamdc4 UTSW 2 25,456,093 (GRCm39) missense probably damaging 1.00
R8531:Mamdc4 UTSW 2 25,457,730 (GRCm39) missense possibly damaging 0.56
R8810:Mamdc4 UTSW 2 25,458,501 (GRCm39) missense probably benign 0.01
R9069:Mamdc4 UTSW 2 25,453,371 (GRCm39) missense probably damaging 1.00
R9440:Mamdc4 UTSW 2 25,455,600 (GRCm39) missense probably benign
R9446:Mamdc4 UTSW 2 25,453,645 (GRCm39) missense probably benign
R9486:Mamdc4 UTSW 2 25,455,164 (GRCm39) missense probably benign 0.00
R9551:Mamdc4 UTSW 2 25,460,035 (GRCm39) missense probably damaging 0.98
R9626:Mamdc4 UTSW 2 25,458,273 (GRCm39) missense probably damaging 1.00
X0022:Mamdc4 UTSW 2 25,460,204 (GRCm39) missense probably damaging 1.00
X0025:Mamdc4 UTSW 2 25,454,698 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCCCTGCAAAGAAGTGAAGTTTAG -3'
(R):5'- AACTTTGAACGGGACTCCTGC -3'

Sequencing Primer
(F):5'- AGTTTAGACGGGACCAGCC -3'
(R):5'- AACGGGACTCCTGCAGCTG -3'
Posted On 2020-07-13