Mutagenetix > Incidental Mutation

Incidental Mutation 'R8213:Xirp2'

636237

Institutional Source

Beutler Lab

Gene Symbol

Xirp2

Ensembl Gene

ENSMUSG00000027022

Gene Name

xin actin-binding repeat containing 2

Synonyms

2310003D02Rik, 2310008C07Rik, myomaxin, Cmya3, A530024P18Rik, mXin beta

MMRRC Submission

Accession Numbers

Genbank: NM_001024618, NM_001083919; MGI: 2685198

Essential gene?

Possibly non essential (E-score: 0.470) question?

Stock #

R8213 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

67446002-67526614 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 67476866 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 19 (N19K)

Ref Sequence

ENSEMBL: ENSMUSP00000028410 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028410] [ENSMUST00000112347]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000028410
AA Change: N19K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000028410
Gene: ENSMUSG00000027022
AA Change: N19K

Domain	Start	End	E-Value	Type
low complexity region	176	188	N/A	INTRINSIC
low complexity region	194	208	N/A	INTRINSIC
low complexity region	289	298	N/A	INTRINSIC
Pfam:Xin	343	358	4e-9	PFAM
Pfam:Xin	384	398	7.6e-10	PFAM
Pfam:Xin	420	435	6.4e-9	PFAM
Pfam:Xin	458	473	5.3e-9	PFAM
Pfam:Xin	536	551	4.1e-12	PFAM
Pfam:Xin	574	588	2.1e-8	PFAM
Pfam:Xin	609	623	6e-9	PFAM
Pfam:Xin	642	656	5.6e-8	PFAM
Pfam:Xin	679	693	5.9e-8	PFAM
Pfam:Xin	784	799	1.1e-10	PFAM
Pfam:Xin	822	837	3.9e-11	PFAM
Pfam:Xin	861	875	8.6e-12	PFAM
Pfam:Xin	894	909	2.8e-10	PFAM
Pfam:Xin	1006	1021	3.1e-9	PFAM
Pfam:Xin	1079	1094	6.7e-10	PFAM
Pfam:Xin	1117	1132	1.5e-10	PFAM
Pfam:Xin	1154	1169	2.4e-8	PFAM
Pfam:Xin	1256	1271	4.6e-8	PFAM
Pfam:Xin	1292	1305	1.6e-8	PFAM
low complexity region	1314	1325	N/A	INTRINSIC
low complexity region	1547	1559	N/A	INTRINSIC
coiled coil region	1683	1704	N/A	INTRINSIC
low complexity region	1862	1871	N/A	INTRINSIC
low complexity region	2031	2043	N/A	INTRINSIC
low complexity region	2052	2063	N/A	INTRINSIC
low complexity region	2087	2093	N/A	INTRINSIC
low complexity region	2105	2123	N/A	INTRINSIC
low complexity region	2159	2177	N/A	INTRINSIC
coiled coil region	2288	2311	N/A	INTRINSIC
coiled coil region	2738	2767	N/A	INTRINSIC
low complexity region	2794	2804	N/A	INTRINSIC
low complexity region	2906	2919	N/A	INTRINSIC
LIM	3256	3308	4.45e-12	SMART
low complexity region	3356	3367	N/A	INTRINSIC
low complexity region	3549	3565	N/A	INTRINSIC
low complexity region	3614	3625	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112347
AA Change: N19K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107966
Gene: ENSMUSG00000027022
AA Change: N19K

Domain	Start	End	E-Value	Type
low complexity region	176	188	N/A	INTRINSIC
low complexity region	194	208	N/A	INTRINSIC
low complexity region	289	298	N/A	INTRINSIC
Pfam:Xin	343	358	4.3e-8	PFAM
Pfam:Xin	383	398	6.9e-9	PFAM
Pfam:Xin	420	435	1.8e-8	PFAM
Pfam:Xin	458	473	6.9e-8	PFAM
Pfam:Xin	536	551	2.8e-10	PFAM
Pfam:Xin	608	623	2.4e-8	PFAM
Pfam:Xin	642	657	1.7e-7	PFAM
Pfam:Xin	784	799	3.5e-9	PFAM
Pfam:Xin	822	837	8.9e-10	PFAM
Pfam:Xin	861	876	3.9e-10	PFAM
Pfam:Xin	894	909	5.4e-9	PFAM
Pfam:Xin	1006	1021	6.2e-8	PFAM
Pfam:Xin	1079	1094	2.4e-8	PFAM
Pfam:Xin	1117	1132	9.5e-9	PFAM
Pfam:Xin	1291	1306	5.8e-8	PFAM
low complexity region	1314	1325	N/A	INTRINSIC
low complexity region	1547	1559	N/A	INTRINSIC
coiled coil region	1683	1704	N/A	INTRINSIC
low complexity region	1862	1871	N/A	INTRINSIC
low complexity region	2031	2043	N/A	INTRINSIC
low complexity region	2052	2063	N/A	INTRINSIC
low complexity region	2087	2093	N/A	INTRINSIC
low complexity region	2105	2123	N/A	INTRINSIC
low complexity region	2159	2177	N/A	INTRINSIC
coiled coil region	2288	2311	N/A	INTRINSIC
coiled coil region	2738	2767	N/A	INTRINSIC
low complexity region	2794	2804	N/A	INTRINSIC
low complexity region	2906	2919	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.1%

Validation Efficiency

98% (65/66)

MGI Phenotype

Strain: 4947971; 4453315
Lethality: D3-D21
PHENOTYPE: Homozygous null mice have an abnormal heart shape, ventricular septal defects, a failure of mature intercalated disc formation, severe growth retardation, and postnatal lethality. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	C	15: 60,919,756	Y277C	probably damaging	Het
Acss1	T	A	2: 150,619,710	D651V	possibly damaging	Het
Aktip	G	T	8: 91,124,866	P243H	possibly damaging	Het
Arl11	T	G	14: 61,311,265	S175A	probably benign	Het
Aup1	A	G	6: 83,054,607		probably benign	Het
Avil	A	T	10: 127,008,321	I250F	probably damaging	Het
Btnl6	A	T	17: 34,508,883		probably null	Het
C77080	A	T	4: 129,221,459	V1070D	possibly damaging	Het
Ccdc7b	C	A	8: 129,178,291	Q137K	probably benign	Het
Cdk11b	G	A	4: 155,639,881	E319K	unknown	Het
Chka	A	C	19: 3,885,882	E196A	probably damaging	Het
Depdc5	C	T	5: 32,937,637	R753C	probably damaging	Het
Dhx57	T	A	17: 80,275,156	D340V	possibly damaging	Het
Dicer1	A	T	12: 104,702,693	D1243E	probably benign	Het
Dnajb9	A	T	12: 44,207,133	L164M	probably benign	Het
Dock6	A	G	9: 21,831,444	V785A	possibly damaging	Het
Efcab5	T	C	11: 77,116,071	Y909C	probably damaging	Het
Erp44	A	T	4: 48,208,783	S226T	probably benign	Het
Fgd6	A	T	10: 94,044,052	D256V	probably benign	Het
Fhl5	A	T	4: 25,207,113	Y218*	probably null	Het
Filip1	C	A	9: 79,818,092	A1082S	probably benign	Het
Gm13088	T	A	4: 143,654,185	M423L	probably benign	Het
Gm13128	A	T	4: 144,330,460	D71V	probably benign	Het
Heatr5a	G	A	12: 51,891,443	T1484M	probably damaging	Het
Herc1	G	T	9: 66,450,888	R2417L	probably damaging	Het
Hnrnpr	A	G	4: 136,317,175		probably benign	Het
Igsf5	A	T	16: 96,372,988	I73F	probably damaging	Het
Il17ra	T	C	6: 120,473,034	V91A	probably benign	Het
Inpp5f	A	G	7: 128,679,805	D510G	probably damaging	Het
Kbtbd3	A	G	9: 4,331,269	K548E	probably damaging	Het
Kdm5d	T	A	Y: 941,515	C1239S	probably damaging	Het
Mamdc4	G	A	2: 25,566,356	T709M	probably benign	Het
Mybbp1a	T	A	11: 72,444,721	Y353N	probably damaging	Het
Nepn	A	T	10: 52,391,759	E40D	probably benign	Het
Npat	G	T	9: 53,570,570	E1193*	probably null	Het
Nrde2	G	A	12: 100,131,003	S846L	probably benign	Het
Nup205	T	C	6: 35,225,203	V1290A	probably benign	Het
Olfr1009	T	A	2: 85,721,501	L32Q	probably null	Het
Olfr1424	A	G	19: 12,059,092	V220A	probably benign	Het
Olfr517	C	A	7: 108,868,519	V212L	probably benign	Het
Pde6a	A	T	18: 61,220,696	K31M	possibly damaging	Het
Pms2	C	T	5: 143,914,771	R169C	probably damaging	Het
Polr2g	A	T	19: 8,798,257	L30Q	probably damaging	Het
Prdm15	T	A	16: 97,807,060	H679L	probably damaging	Het
Prl4a1	T	G	13: 28,023,386	Y214*	probably null	Het
Prlr	C	T	15: 10,329,242	T601M	possibly damaging	Het
Psen2	A	C	1: 180,245,691	S22A	probably benign	Het
Ralgapa1	C	A	12: 55,722,914	R764L	probably damaging	Het
Scgb2b11	T	C	7: 32,209,408	E89G	probably damaging	Het
Serpina10	T	C	12: 103,628,277	I228V	probably benign	Het
Serpinb1a	T	A	13: 32,842,999	H320L	probably damaging	Het
Sesn2	C	A	4: 132,498,053	Q267H	possibly damaging	Het
Sgsm1	A	T	5: 113,251,011	W1019R	probably damaging	Het
Sqle	A	G	15: 59,321,302		probably null	Het
Syt14	T	C	1: 192,986,829	M39V	probably benign	Het
Tgm7	A	G	2: 121,101,064	V206A	probably damaging	Het
Thbs4	T	C	13: 92,760,586		probably null	Het
Trpv1	T	C	11: 73,254,251	F721S	probably damaging	Het
Ttll10	A	T	4: 156,036,234	M433K	probably benign	Het
Vmn1r216	T	C	13: 23,099,525	I126T	probably benign	Het
Vmn2r108	G	A	17: 20,470,088	S494F	probably benign	Het
Vwa3b	C	T	1: 37,128,939	A603V	probably benign	Het
Zfp397	T	A	18: 23,960,722	N421K	probably damaging	Het
Zscan5b	C	T	7: 6,233,947	P232S	possibly damaging	Het

Other mutations in Xirp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Xirp2	APN	2	67513375	missense	probably benign	0.37
IGL00336:Xirp2	APN	2	67512598	missense	possibly damaging	0.93
IGL00596:Xirp2	APN	2	67514882	missense	probably benign	0.08
IGL00862:Xirp2	APN	2	67516903	missense	probably benign	0.00
IGL01124:Xirp2	APN	2	67508615	missense	probably damaging	0.99
IGL01289:Xirp2	APN	2	67513181	missense	probably damaging	0.99
IGL01293:Xirp2	APN	2	67515184	missense	possibly damaging	0.51
IGL01372:Xirp2	APN	2	67513990	missense	possibly damaging	0.93
IGL01385:Xirp2	APN	2	67509677	missense	probably damaging	0.99
IGL01411:Xirp2	APN	2	67514083	missense	probably benign	0.00
IGL01413:Xirp2	APN	2	67509926	missense	probably damaging	1.00
IGL01551:Xirp2	APN	2	67513505	missense	probably benign
IGL01672:Xirp2	APN	2	67508502	missense	probably benign
IGL01724:Xirp2	APN	2	67526067	missense	probably benign
IGL01739:Xirp2	APN	2	67515138	missense	probably benign	0.15
IGL01807:Xirp2	APN	2	67515031	missense	probably benign
IGL02006:Xirp2	APN	2	67511962	missense	possibly damaging	0.85
IGL02030:Xirp2	APN	2	67508981	missense	probably benign	0.06
IGL02066:Xirp2	APN	2	67526071	missense	probably benign
IGL02138:Xirp2	APN	2	67516956	missense	probably benign	0.15
IGL02250:Xirp2	APN	2	67514012	missense	probably benign	0.03
IGL02265:Xirp2	APN	2	67517150	missense	possibly damaging	0.94
IGL02274:Xirp2	APN	2	67508651	missense	probably benign	0.12
IGL02322:Xirp2	APN	2	67508738	missense	probably benign	0.00
IGL02327:Xirp2	APN	2	67510100	missense	probably damaging	1.00
IGL02378:Xirp2	APN	2	67513768	missense	probably benign	0.00
IGL02492:Xirp2	APN	2	67516167	missense	probably damaging	0.99
IGL02549:Xirp2	APN	2	67513102	missense	probably benign	0.03
IGL02578:Xirp2	APN	2	67511247	missense	probably damaging	0.96
IGL02635:Xirp2	APN	2	67507910	missense	possibly damaging	0.86
IGL02654:Xirp2	APN	2	67514671	missense	possibly damaging	0.86
IGL02663:Xirp2	APN	2	67509458	missense	possibly damaging	0.92
IGL02795:Xirp2	APN	2	67509136	missense	probably damaging	1.00
IGL02934:Xirp2	APN	2	67515676	missense	probably benign	0.33
IGL03003:Xirp2	APN	2	67515562	missense	possibly damaging	0.93
IGL03069:Xirp2	APN	2	67509532	missense	possibly damaging	0.91
IGL03286:Xirp2	APN	2	67516310	missense	probably damaging	0.99
IGL03326:Xirp2	APN	2	67482246	missense	probably benign	0.01
IGL03381:Xirp2	APN	2	67514226	missense	probably benign	0.34
IGL03394:Xirp2	APN	2	67515194	missense	probably damaging	0.99
Ordovician	UTSW	2	67482363	missense	possibly damaging	0.72
silurian	UTSW	2	67519265	missense	probably damaging	0.99
3-1:Xirp2	UTSW	2	67508198	missense	possibly damaging	0.95
H8562:Xirp2	UTSW	2	67515457	missense	probably benign
PIT4142001:Xirp2	UTSW	2	67519362	splice site	probably benign
PIT4260001:Xirp2	UTSW	2	67511597	missense	possibly damaging	0.96
PIT4445001:Xirp2	UTSW	2	67509772	missense	possibly damaging	0.84
PIT4531001:Xirp2	UTSW	2	67515482	missense	possibly damaging	0.73
R0015:Xirp2	UTSW	2	67510899	nonsense	probably null
R0063:Xirp2	UTSW	2	67509083	missense	probably damaging	0.99
R0063:Xirp2	UTSW	2	67509083	missense	probably damaging	0.99
R0066:Xirp2	UTSW	2	67512140	missense	possibly damaging	0.85
R0109:Xirp2	UTSW	2	67519278	missense	probably damaging	1.00
R0111:Xirp2	UTSW	2	67508378	missense	probably damaging	0.99
R0115:Xirp2	UTSW	2	67509909	missense	possibly damaging	0.92
R0117:Xirp2	UTSW	2	67517120	missense	possibly damaging	0.94
R0133:Xirp2	UTSW	2	67517124	missense	probably benign
R0282:Xirp2	UTSW	2	67513380	missense	probably damaging	0.96
R0463:Xirp2	UTSW	2	67514918	missense	probably benign	0.02
R0481:Xirp2	UTSW	2	67509909	missense	possibly damaging	0.92
R0488:Xirp2	UTSW	2	67514821	missense	possibly damaging	0.90
R0548:Xirp2	UTSW	2	67514414	missense	probably benign	0.00
R0557:Xirp2	UTSW	2	67516351	missense	probably benign	0.33
R0582:Xirp2	UTSW	2	67508866	missense	probably benign
R0723:Xirp2	UTSW	2	67512215	missense	probably damaging	0.98
R0835:Xirp2	UTSW	2	67507910	missense	possibly damaging	0.86
R1160:Xirp2	UTSW	2	67509887	missense	possibly damaging	0.92
R1189:Xirp2	UTSW	2	67513461	missense	probably damaging	0.96
R1474:Xirp2	UTSW	2	67525067	missense	probably benign	0.00
R1513:Xirp2	UTSW	2	67511530	missense	probably benign	0.00
R1514:Xirp2	UTSW	2	67514323	nonsense	probably null
R1519:Xirp2	UTSW	2	67515679	missense	probably benign	0.44
R1532:Xirp2	UTSW	2	67513939	missense	probably benign	0.00
R1537:Xirp2	UTSW	2	67510013	missense	probably damaging	0.98
R1541:Xirp2	UTSW	2	67512290	missense	possibly damaging	0.70
R1543:Xirp2	UTSW	2	67508039	missense	probably benign
R1607:Xirp2	UTSW	2	67510295	nonsense	probably null
R1620:Xirp2	UTSW	2	67510835	missense	probably damaging	0.98
R1709:Xirp2	UTSW	2	67509871	missense	probably benign	0.33
R1713:Xirp2	UTSW	2	67512418	missense	probably benign	0.25
R1828:Xirp2	UTSW	2	67515238	missense	possibly damaging	0.86
R1834:Xirp2	UTSW	2	67511140	missense	probably damaging	0.99
R1905:Xirp2	UTSW	2	67516356	missense	probably damaging	0.98
R1907:Xirp2	UTSW	2	67516356	missense	probably damaging	0.98
R1943:Xirp2	UTSW	2	67512615	missense	probably benign	0.34
R1971:Xirp2	UTSW	2	67511695	missense	possibly damaging	0.48
R1998:Xirp2	UTSW	2	67509049	missense	probably damaging	0.97
R2075:Xirp2	UTSW	2	67510201	missense	probably benign	0.33
R2132:Xirp2	UTSW	2	67508048	missense	possibly damaging	0.72
R2175:Xirp2	UTSW	2	67509914	missense	probably damaging	0.99
R2310:Xirp2	UTSW	2	67526247	missense	probably benign	0.19
R2338:Xirp2	UTSW	2	67510770	missense	probably damaging	0.98
R2426:Xirp2	UTSW	2	67514471	missense	probably benign	0.02
R2483:Xirp2	UTSW	2	67524992	missense	probably benign
R3084:Xirp2	UTSW	2	67509049	missense	probably damaging	0.97
R3113:Xirp2	UTSW	2	67510147	missense	probably benign	0.33
R3903:Xirp2	UTSW	2	67508036	missense	probably benign	0.40
R3916:Xirp2	UTSW	2	67511422	missense	probably benign	0.25
R3928:Xirp2	UTSW	2	67511669	missense	possibly damaging	0.85
R4025:Xirp2	UTSW	2	67511402	missense	probably benign	0.12
R4135:Xirp2	UTSW	2	67525397	missense	probably benign	0.00
R4223:Xirp2	UTSW	2	67516493	missense	possibly damaging	0.66
R4257:Xirp2	UTSW	2	67516039	missense	probably benign	0.31
R4499:Xirp2	UTSW	2	67513438	missense	probably benign	0.08
R4577:Xirp2	UTSW	2	67513897	missense	probably damaging	0.99
R4739:Xirp2	UTSW	2	67519265	missense	probably damaging	0.99
R4758:Xirp2	UTSW	2	67516535	missense	probably damaging	0.98
R4834:Xirp2	UTSW	2	67516406	missense	probably benign	0.26
R4855:Xirp2	UTSW	2	67511064	missense	possibly damaging	0.96
R4923:Xirp2	UTSW	2	67512893	missense	probably benign
R4936:Xirp2	UTSW	2	67509819	missense	possibly damaging	0.85
R5032:Xirp2	UTSW	2	67525670	missense	possibly damaging	0.84
R5049:Xirp2	UTSW	2	67517134	missense	probably benign	0.03
R5077:Xirp2	UTSW	2	67514477	missense	probably benign
R5090:Xirp2	UTSW	2	67525470	missense	possibly damaging	0.83
R5107:Xirp2	UTSW	2	67509710	missense	probably damaging	0.99
R5107:Xirp2	UTSW	2	67511861	missense	probably damaging	1.00
R5187:Xirp2	UTSW	2	67515367	missense	probably benign	0.01
R5241:Xirp2	UTSW	2	67482360	nonsense	probably null
R5307:Xirp2	UTSW	2	67511162	missense	probably damaging	0.99
R5342:Xirp2	UTSW	2	67513461	missense	probably damaging	0.96
R5370:Xirp2	UTSW	2	67512152	missense	possibly damaging	0.72
R5375:Xirp2	UTSW	2	67511906	missense	probably damaging	0.99
R5407:Xirp2	UTSW	2	67510969	missense	probably benign	0.33
R5514:Xirp2	UTSW	2	67505121	missense	probably benign	0.03
R5531:Xirp2	UTSW	2	67515302	missense	probably benign	0.42
R5590:Xirp2	UTSW	2	67514035	missense	probably benign	0.23
R5646:Xirp2	UTSW	2	67510790	missense	probably damaging	0.99
R5649:Xirp2	UTSW	2	67516895	missense	probably benign	0.00
R5686:Xirp2	UTSW	2	67482298	missense	probably damaging	0.99
R5761:Xirp2	UTSW	2	67510967	missense	probably benign	0.00
R5777:Xirp2	UTSW	2	67510004	missense	possibly damaging	0.92
R5785:Xirp2	UTSW	2	67509662	missense	probably damaging	0.96
R5843:Xirp2	UTSW	2	67476785	start gained	probably benign
R5846:Xirp2	UTSW	2	67509243	missense	probably damaging	0.98
R5875:Xirp2	UTSW	2	67505080	missense	probably benign	0.00
R5896:Xirp2	UTSW	2	67508698	missense	probably benign	0.32
R5896:Xirp2	UTSW	2	67509946	missense	possibly damaging	0.91
R5901:Xirp2	UTSW	2	67513066	missense	possibly damaging	0.91
R5934:Xirp2	UTSW	2	67524804	missense	possibly damaging	0.92
R5950:Xirp2	UTSW	2	67511320	missense	possibly damaging	0.95
R5996:Xirp2	UTSW	2	67511650	missense	possibly damaging	0.91
R6013:Xirp2	UTSW	2	67510943	missense	possibly damaging	0.48
R6048:Xirp2	UTSW	2	67508243	missense	possibly damaging	0.96
R6111:Xirp2	UTSW	2	67511817	missense	possibly damaging	0.86
R6180:Xirp2	UTSW	2	67505577	critical splice donor site	probably null
R6342:Xirp2	UTSW	2	67511650	missense	possibly damaging	0.91
R6346:Xirp2	UTSW	2	67516081	missense	probably benign	0.00
R6603:Xirp2	UTSW	2	67516544	missense	probably benign
R6604:Xirp2	UTSW	2	67509845	missense	possibly damaging	0.86
R6669:Xirp2	UTSW	2	67513355	missense	possibly damaging	0.78
R6701:Xirp2	UTSW	2	67516225	missense	possibly damaging	0.94
R6726:Xirp2	UTSW	2	67512868	missense	possibly damaging	0.88
R6833:Xirp2	UTSW	2	67509950	missense	probably benign	0.12
R6897:Xirp2	UTSW	2	67508567	missense	probably damaging	1.00
R6933:Xirp2	UTSW	2	67514857	missense	probably benign	0.34
R7020:Xirp2	UTSW	2	67525569	missense	probably benign
R7042:Xirp2	UTSW	2	67513289	missense	probably benign	0.12
R7060:Xirp2	UTSW	2	67515608	missense	probably damaging	1.00
R7179:Xirp2	UTSW	2	67509833	missense	probably benign	0.00
R7229:Xirp2	UTSW	2	67525551	missense	probably damaging	0.99
R7253:Xirp2	UTSW	2	67513482	missense	probably benign
R7284:Xirp2	UTSW	2	67516829	missense	probably benign
R7450:Xirp2	UTSW	2	67509815	missense	possibly damaging	0.86
R7476:Xirp2	UTSW	2	67510634	missense	probably benign	0.01
R7489:Xirp2	UTSW	2	67525560	missense	possibly damaging	0.83
R7513:Xirp2	UTSW	2	67510764	missense	possibly damaging	0.86
R7549:Xirp2	UTSW	2	67508897	missense	possibly damaging	0.91
R7563:Xirp2	UTSW	2	67509901	missense	probably damaging	0.99
R7567:Xirp2	UTSW	2	67515982	missense	probably benign	0.02
R7577:Xirp2	UTSW	2	67514965	missense	possibly damaging	0.65
R7597:Xirp2	UTSW	2	67525755	missense	possibly damaging	0.84
R7610:Xirp2	UTSW	2	67525962	missense	possibly damaging	0.92
R7613:Xirp2	UTSW	2	67514498	missense	probably benign	0.00
R7669:Xirp2	UTSW	2	67512177	missense	probably benign	0.00
R7670:Xirp2	UTSW	2	67510573	missense	possibly damaging	0.91
R7673:Xirp2	UTSW	2	67517087	missense	probably damaging	1.00
R7682:Xirp2	UTSW	2	67508849	missense	probably damaging	0.99
R7755:Xirp2	UTSW	2	67515182	missense	probably benign
R7805:Xirp2	UTSW	2	67509981	missense	probably benign	0.23
R7815:Xirp2	UTSW	2	67509412	missense	probably damaging	1.00
R7823:Xirp2	UTSW	2	67511774	missense	probably damaging	1.00
R7842:Xirp2	UTSW	2	67524945	missense	probably benign	0.00
R7863:Xirp2	UTSW	2	67512730	missense	probably benign	0.03
R7895:Xirp2	UTSW	2	67509497	missense	probably damaging	0.96
R7948:Xirp2	UTSW	2	67519314	missense	possibly damaging	0.95
R8083:Xirp2	UTSW	2	67508699	missense	possibly damaging	0.71
R8125:Xirp2	UTSW	2	67512035	missense	probably benign	0.25
R8154:Xirp2	UTSW	2	67511673	missense	possibly damaging	0.48
R8169:Xirp2	UTSW	2	67513199	missense	probably benign	0.00
R8215:Xirp2	UTSW	2	67516509	missense	probably benign	0.08
R8230:Xirp2	UTSW	2	67515665	missense	probably damaging	0.99
R8266:Xirp2	UTSW	2	67508574	missense	probably damaging	0.98
R8350:Xirp2	UTSW	2	67525369	missense	probably benign
R8432:Xirp2	UTSW	2	67510618	missense	probably benign
R8441:Xirp2	UTSW	2	67512815	missense	possibly damaging	0.85
R8677:Xirp2	UTSW	2	67516634	missense	probably damaging	0.98
R8773:Xirp2	UTSW	2	67525183	missense	probably benign
R8794:Xirp2	UTSW	2	67511213	missense	probably damaging	0.98
R8930:Xirp2	UTSW	2	67482363	missense	possibly damaging	0.72
R8932:Xirp2	UTSW	2	67482363	missense	possibly damaging	0.72
R8939:Xirp2	UTSW	2	67516144	missense	probably benign	0.04
R9263:Xirp2	UTSW	2	67514945	missense	possibly damaging	0.76
R9313:Xirp2	UTSW	2	67516978	missense	probably damaging	0.99
R9350:Xirp2	UTSW	2	67519309	missense	probably damaging	1.00
R9375:Xirp2	UTSW	2	67511774	missense	probably damaging	1.00
R9442:Xirp2	UTSW	2	67511891	nonsense	probably null
R9447:Xirp2	UTSW	2	67508606	missense	probably damaging	0.98
R9457:Xirp2	UTSW	2	67515632	missense	probably benign	0.03
R9507:Xirp2	UTSW	2	67513936	missense	possibly damaging	0.95
R9529:Xirp2	UTSW	2	67525196	missense	possibly damaging	0.93
R9569:Xirp2	UTSW	2	67510898	missense	probably damaging	1.00
R9607:Xirp2	UTSW	2	67510762	missense	possibly damaging	0.72
R9648:Xirp2	UTSW	2	67516255	missense	probably benign
R9651:Xirp2	UTSW	2	67513823	missense	possibly damaging	0.72
R9678:Xirp2	UTSW	2	67509444	missense	possibly damaging	0.91
R9691:Xirp2	UTSW	2	67510195	missense	possibly damaging	0.91
R9777:Xirp2	UTSW	2	67517035	missense	possibly damaging	0.85
RF035:Xirp2	UTSW	2	67525544	utr 3 prime	probably benign
RF040:Xirp2	UTSW	2	67525544	utr 3 prime	probably benign
X0063:Xirp2	UTSW	2	67516123	missense	probably benign	0.04
X0065:Xirp2	UTSW	2	67515118	missense	probably benign	0.34
Z1088:Xirp2	UTSW	2	67513321	missense	probably benign	0.03
Z1176:Xirp2	UTSW	2	67511393	missense	probably damaging	0.99
Z1176:Xirp2	UTSW	2	67514579	missense	probably benign	0.17
Z1176:Xirp2	UTSW	2	67525232	missense	probably damaging	1.00
Z1177:Xirp2	UTSW	2	67510193	frame shift	probably null
Z1177:Xirp2	UTSW	2	67525371	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GACACCTATCTGAAAATGCTACG -3'
(R):5'- ACACATTTACGGAGTGCCTCC -3'

Sequencing Primer
(F):5'- AATGCTACGTTTGTTTTCAGTGACC -3'
(R):5'- CGAGGCTTCAAGTCAGAAGTTCTC -3'

Posted On

2020-07-13