Incidental Mutation 'R8213:Olfr1009'
ID636238
Institutional Source Beutler Lab
Gene Symbol Olfr1009
Ensembl Gene ENSMUSG00000043226
Gene Nameolfactory receptor 1009
SynonymsMOR175-3, GA_x6K02T2Q125-47195323-47196267
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R8213 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85715419-85725136 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85721501 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 32 (L32Q)
Ref Sequence ENSEMBL: ENSMUSP00000061475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055517]
Predicted Effect probably null
Transcript: ENSMUST00000055517
AA Change: L32Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061475
Gene: ENSMUSG00000043226
AA Change: L32Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.4e-55 PFAM
Pfam:7tm_1 41 290 4.3e-18 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,756 Y277C probably damaging Het
Acss1 T A 2: 150,619,710 D651V possibly damaging Het
Aktip G T 8: 91,124,866 P243H possibly damaging Het
Arl11 T G 14: 61,311,265 S175A probably benign Het
Aup1 A G 6: 83,054,607 probably benign Het
Avil A T 10: 127,008,321 I250F probably damaging Het
Btnl6 A T 17: 34,508,883 probably null Het
C77080 A T 4: 129,221,459 V1070D possibly damaging Het
Ccdc7b C A 8: 129,178,291 Q137K probably benign Het
Cdk11b G A 4: 155,639,881 E319K unknown Het
Chka A C 19: 3,885,882 E196A probably damaging Het
Depdc5 C T 5: 32,937,637 R753C probably damaging Het
Dhx57 T A 17: 80,275,156 D340V possibly damaging Het
Dicer1 A T 12: 104,702,693 D1243E probably benign Het
Dnajb9 A T 12: 44,207,133 L164M probably benign Het
Dock6 A G 9: 21,831,444 V785A possibly damaging Het
Efcab5 T C 11: 77,116,071 Y909C probably damaging Het
Erp44 A T 4: 48,208,783 S226T probably benign Het
Fgd6 A T 10: 94,044,052 D256V probably benign Het
Fhl5 A T 4: 25,207,113 Y218* probably null Het
Filip1 C A 9: 79,818,092 A1082S probably benign Het
Gm13088 T A 4: 143,654,185 M423L probably benign Het
Gm13128 A T 4: 144,330,460 D71V probably benign Het
Heatr5a G A 12: 51,891,443 T1484M probably damaging Het
Herc1 G T 9: 66,450,888 R2417L probably damaging Het
Hnrnpr A G 4: 136,317,175 probably benign Het
Igsf5 A T 16: 96,372,988 I73F probably damaging Het
Il17ra T C 6: 120,473,034 V91A probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 K548E probably damaging Het
Kdm5d T A Y: 941,515 C1239S probably damaging Het
Mamdc4 G A 2: 25,566,356 T709M probably benign Het
Mybbp1a T A 11: 72,444,721 Y353N probably damaging Het
Nepn A T 10: 52,391,759 E40D probably benign Het
Npat G T 9: 53,570,570 E1193* probably null Het
Nrde2 G A 12: 100,131,003 S846L probably benign Het
Nup205 T C 6: 35,225,203 V1290A probably benign Het
Olfr1424 A G 19: 12,059,092 V220A probably benign Het
Olfr517 C A 7: 108,868,519 V212L probably benign Het
Pde6a A T 18: 61,220,696 K31M possibly damaging Het
Pms2 C T 5: 143,914,771 R169C probably damaging Het
Polr2g A T 19: 8,798,257 L30Q probably damaging Het
Prdm15 T A 16: 97,807,060 H679L probably damaging Het
Prl4a1 T G 13: 28,023,386 Y214* probably null Het
Prlr C T 15: 10,329,242 T601M possibly damaging Het
Psen2 A C 1: 180,245,691 S22A probably benign Het
Ralgapa1 C A 12: 55,722,914 R764L probably damaging Het
Scgb2b11 T C 7: 32,209,408 E89G probably damaging Het
Serpina10 T C 12: 103,628,277 I228V probably benign Het
Serpinb1a T A 13: 32,842,999 H320L probably damaging Het
Sesn2 C A 4: 132,498,053 Q267H possibly damaging Het
Sgsm1 A T 5: 113,251,011 W1019R probably damaging Het
Sqle A G 15: 59,321,302 probably null Het
Syt14 T C 1: 192,986,829 M39V probably benign Het
Tgm7 A G 2: 121,101,064 V206A probably damaging Het
Thbs4 T C 13: 92,760,586 probably null Het
Trpv1 T C 11: 73,254,251 F721S probably damaging Het
Ttll10 A T 4: 156,036,234 M433K probably benign Het
Vmn1r216 T C 13: 23,099,525 I126T probably benign Het
Vmn2r108 G A 17: 20,470,088 S494F probably benign Het
Vwa3b C T 1: 37,128,939 A603V probably benign Het
Xirp2 T A 2: 67,476,866 N19K probably damaging Het
Zfp397 T A 18: 23,960,722 N421K probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Olfr1009
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Olfr1009 APN 2 85722239 missense probably damaging 1.00
IGL01862:Olfr1009 APN 2 85722128 missense probably damaging 0.99
IGL02868:Olfr1009 APN 2 85721575 missense probably benign 0.19
IGL02904:Olfr1009 APN 2 85721755 missense probably damaging 0.99
IGL03240:Olfr1009 APN 2 85722331 nonsense probably null
IGL03347:Olfr1009 APN 2 85721807 missense probably benign 0.01
R1148:Olfr1009 UTSW 2 85722276 nonsense probably null
R1148:Olfr1009 UTSW 2 85722276 nonsense probably null
R1446:Olfr1009 UTSW 2 85721573 missense probably damaging 0.99
R3782:Olfr1009 UTSW 2 85721696 missense probably damaging 1.00
R4343:Olfr1009 UTSW 2 85722248 missense probably damaging 1.00
R4836:Olfr1009 UTSW 2 85721449 missense probably benign
R4845:Olfr1009 UTSW 2 85721492 nonsense probably null
R5490:Olfr1009 UTSW 2 85722322 missense probably benign 0.01
R5534:Olfr1009 UTSW 2 85721987 missense probably benign 0.35
R5679:Olfr1009 UTSW 2 85722046 missense probably damaging 1.00
R6476:Olfr1009 UTSW 2 85721584 missense probably damaging 1.00
R6701:Olfr1009 UTSW 2 85722331 missense probably benign 0.28
R7024:Olfr1009 UTSW 2 85721608 missense probably damaging 1.00
R7140:Olfr1009 UTSW 2 85721474 missense probably damaging 0.97
R7174:Olfr1009 UTSW 2 85721953 missense possibly damaging 0.81
R8079:Olfr1009 UTSW 2 85722043 missense probably benign 0.07
R8082:Olfr1009 UTSW 2 85721480 missense probably benign 0.01
X0020:Olfr1009 UTSW 2 85721978 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTCTTGTGCATTACCAAGAAG -3'
(R):5'- AGAGAAGACACTCAATGGCC -3'

Sequencing Primer
(F):5'- GCATTACCAAGAAGTTTTAAGACAC -3'
(R):5'- GAACCCAAAGAACCATTGCTG -3'
Posted On2020-07-13