Incidental Mutation 'R8213:Tgm7'
ID 636239
Institutional Source Beutler Lab
Gene Symbol Tgm7
Ensembl Gene ENSMUSG00000079103
Gene Name transglutaminase 7
Synonyms TGz
MMRRC Submission 067655-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R8213 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 120924046-120946877 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120931545 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 206 (V206A)
Ref Sequence ENSEMBL: ENSMUSP00000106303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110675]
AlphaFold A2ART8
Predicted Effect probably damaging
Transcript: ENSMUST00000110675
AA Change: V206A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106303
Gene: ENSMUSG00000079103
AA Change: V206A

DomainStartEndE-ValueType
TGc 177 270 2.54e-42 SMART
SCOP:d1kv3a2 395 512 1e-33 SMART
Pfam:Transglut_C 514 612 1.7e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases (TGM; EC 2.3.2.13) are a family of structurally and functionally related enzymes that stabilize protein assemblies through the formation of gamma-glutamyl-epsilon lysine crosslinks. For additional background information on transglutaminases, see TGM1 (MIM 190195).[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,791,605 (GRCm39) Y277C probably damaging Het
Acss1 T A 2: 150,461,630 (GRCm39) D651V possibly damaging Het
Aktip G T 8: 91,851,494 (GRCm39) P243H possibly damaging Het
Arl11 T G 14: 61,548,714 (GRCm39) S175A probably benign Het
Aup1 A G 6: 83,031,588 (GRCm39) probably benign Het
Avil A T 10: 126,844,190 (GRCm39) I250F probably damaging Het
Btnl6 A T 17: 34,727,857 (GRCm39) probably null Het
Ccdc7b C A 8: 129,904,772 (GRCm39) Q137K probably benign Het
Cdk11b G A 4: 155,724,338 (GRCm39) E319K unknown Het
Chka A C 19: 3,935,882 (GRCm39) E196A probably damaging Het
Depdc5 C T 5: 33,094,981 (GRCm39) R753C probably damaging Het
Dhx57 T A 17: 80,582,585 (GRCm39) D340V possibly damaging Het
Dicer1 A T 12: 104,668,952 (GRCm39) D1243E probably benign Het
Dnajb9 A T 12: 44,253,916 (GRCm39) L164M probably benign Het
Dock6 A G 9: 21,742,740 (GRCm39) V785A possibly damaging Het
Efcab5 T C 11: 77,006,897 (GRCm39) Y909C probably damaging Het
Erp44 A T 4: 48,208,783 (GRCm39) S226T probably benign Het
Fgd6 A T 10: 93,879,914 (GRCm39) D256V probably benign Het
Fhl5 A T 4: 25,207,113 (GRCm39) Y218* probably null Het
Filip1 C A 9: 79,725,374 (GRCm39) A1082S probably benign Het
Heatr5a G A 12: 51,938,226 (GRCm39) T1484M probably damaging Het
Herc1 G T 9: 66,358,170 (GRCm39) R2417L probably damaging Het
Hnrnpr A G 4: 136,044,486 (GRCm39) probably benign Het
Igsf5 A T 16: 96,174,188 (GRCm39) I73F probably damaging Het
Il17ra T C 6: 120,449,995 (GRCm39) V91A probably benign Het
Inpp5f A G 7: 128,281,529 (GRCm39) D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 (GRCm39) K548E probably damaging Het
Kdm5d T A Y: 941,515 (GRCm39) C1239S probably damaging Het
Mamdc4 G A 2: 25,456,368 (GRCm39) T709M probably benign Het
Mybbp1a T A 11: 72,335,547 (GRCm39) Y353N probably damaging Het
Nepn A T 10: 52,267,855 (GRCm39) E40D probably benign Het
Nhsl3 A T 4: 129,115,252 (GRCm39) V1070D possibly damaging Het
Npat G T 9: 53,481,870 (GRCm39) E1193* probably null Het
Nrde2 G A 12: 100,097,262 (GRCm39) S846L probably benign Het
Nup205 T C 6: 35,202,138 (GRCm39) V1290A probably benign Het
Or10a49 C A 7: 108,467,726 (GRCm39) V212L probably benign Het
Or4d10b A G 19: 12,036,456 (GRCm39) V220A probably benign Het
Or5g9 T A 2: 85,551,845 (GRCm39) L32Q probably null Het
Pde6a A T 18: 61,353,768 (GRCm39) K31M possibly damaging Het
Pms2 C T 5: 143,851,589 (GRCm39) R169C probably damaging Het
Polr2g A T 19: 8,775,621 (GRCm39) L30Q probably damaging Het
Pramel22 T A 4: 143,380,755 (GRCm39) M423L probably benign Het
Pramel30 A T 4: 144,057,030 (GRCm39) D71V probably benign Het
Prdm15 T A 16: 97,608,260 (GRCm39) H679L probably damaging Het
Prl4a1 T G 13: 28,207,369 (GRCm39) Y214* probably null Het
Prlr C T 15: 10,329,328 (GRCm39) T601M possibly damaging Het
Psen2 A C 1: 180,073,256 (GRCm39) S22A probably benign Het
Ralgapa1 C A 12: 55,769,699 (GRCm39) R764L probably damaging Het
Scgb2b11 T C 7: 31,908,833 (GRCm39) E89G probably damaging Het
Serpina10 T C 12: 103,594,536 (GRCm39) I228V probably benign Het
Serpinb1a T A 13: 33,026,982 (GRCm39) H320L probably damaging Het
Sesn2 C A 4: 132,225,364 (GRCm39) Q267H possibly damaging Het
Sgsm1 A T 5: 113,398,877 (GRCm39) W1019R probably damaging Het
Sqle A G 15: 59,193,151 (GRCm39) probably null Het
Syt14 T C 1: 192,669,137 (GRCm39) M39V probably benign Het
Thbs4 T C 13: 92,897,094 (GRCm39) probably null Het
Trpv1 T C 11: 73,145,077 (GRCm39) F721S probably damaging Het
Ttll10 A T 4: 156,120,691 (GRCm39) M433K probably benign Het
Vmn1r216 T C 13: 23,283,695 (GRCm39) I126T probably benign Het
Vmn2r108 G A 17: 20,690,350 (GRCm39) S494F probably benign Het
Vwa3b C T 1: 37,168,020 (GRCm39) A603V probably benign Het
Xirp2 T A 2: 67,307,210 (GRCm39) N19K probably damaging Het
Zfp397 T A 18: 24,093,779 (GRCm39) N421K probably damaging Het
Zscan5b C T 7: 6,236,946 (GRCm39) P232S possibly damaging Het
Other mutations in Tgm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Tgm7 APN 2 120,937,396 (GRCm39) missense probably benign 0.16
IGL01576:Tgm7 APN 2 120,931,514 (GRCm39) missense probably damaging 1.00
IGL01982:Tgm7 APN 2 120,924,106 (GRCm39) nonsense probably null
IGL02077:Tgm7 APN 2 120,934,316 (GRCm39) missense probably damaging 1.00
IGL02135:Tgm7 APN 2 120,929,519 (GRCm39) missense possibly damaging 0.75
R0063:Tgm7 UTSW 2 120,924,577 (GRCm39) missense probably benign 0.01
R0412:Tgm7 UTSW 2 120,931,546 (GRCm39) missense probably damaging 1.00
R1869:Tgm7 UTSW 2 120,931,570 (GRCm39) missense probably damaging 1.00
R2201:Tgm7 UTSW 2 120,929,062 (GRCm39) missense probably damaging 1.00
R2276:Tgm7 UTSW 2 120,929,045 (GRCm39) missense probably damaging 1.00
R2279:Tgm7 UTSW 2 120,929,045 (GRCm39) missense probably damaging 1.00
R2872:Tgm7 UTSW 2 120,940,174 (GRCm39) start gained probably benign
R2872:Tgm7 UTSW 2 120,940,174 (GRCm39) start gained probably benign
R4523:Tgm7 UTSW 2 120,929,069 (GRCm39) critical splice acceptor site probably null
R4688:Tgm7 UTSW 2 120,924,502 (GRCm39) missense probably benign 0.06
R4757:Tgm7 UTSW 2 120,926,870 (GRCm39) missense possibly damaging 0.75
R4858:Tgm7 UTSW 2 120,929,445 (GRCm39) critical splice donor site probably null
R5132:Tgm7 UTSW 2 120,934,700 (GRCm39) missense probably damaging 1.00
R5141:Tgm7 UTSW 2 120,931,480 (GRCm39) missense probably benign 0.05
R5424:Tgm7 UTSW 2 120,929,522 (GRCm39) missense probably damaging 1.00
R5911:Tgm7 UTSW 2 120,926,454 (GRCm39) missense probably benign 0.27
R6166:Tgm7 UTSW 2 120,929,539 (GRCm39) missense probably damaging 1.00
R6364:Tgm7 UTSW 2 120,926,878 (GRCm39) nonsense probably null
R6636:Tgm7 UTSW 2 120,931,571 (GRCm39) missense probably damaging 1.00
R6637:Tgm7 UTSW 2 120,931,571 (GRCm39) missense probably damaging 1.00
R6950:Tgm7 UTSW 2 120,924,128 (GRCm39) missense probably damaging 1.00
R7094:Tgm7 UTSW 2 120,929,489 (GRCm39) missense probably damaging 1.00
R7536:Tgm7 UTSW 2 120,926,878 (GRCm39) nonsense probably null
R7729:Tgm7 UTSW 2 120,924,191 (GRCm39) missense probably benign
R7822:Tgm7 UTSW 2 120,934,421 (GRCm39) missense probably benign
R8511:Tgm7 UTSW 2 120,924,141 (GRCm39) missense probably damaging 0.99
R9182:Tgm7 UTSW 2 120,926,980 (GRCm39) missense probably benign
R9490:Tgm7 UTSW 2 120,928,867 (GRCm39) missense probably damaging 0.99
R9573:Tgm7 UTSW 2 120,934,606 (GRCm39) missense probably benign
R9656:Tgm7 UTSW 2 120,940,191 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCTCCTAGGCCAAGGAATTCTC -3'
(R):5'- AGGTGGGCAGGAACTTCTC -3'

Sequencing Primer
(F):5'- TAGGCCAAGGAATTCTCTAAGC -3'
(R):5'- GGGCAGGAACTTCTCTTCGTC -3'
Posted On 2020-07-13