Incidental Mutation 'R8213:Acss1'
List |< first << previous [record 2 of 65] next >> last >|
ID636240
Institutional Source Beutler Lab
Gene Symbol Acss1
Ensembl Gene ENSMUSG00000027452
Gene Nameacyl-CoA synthetase short-chain family member 1
SynonymsAcas2l, Acas2, 1110032O15Rik, AceCS2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8213 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location150618105-150668500 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 150619710 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 651 (D651V)
Ref Sequence ENSEMBL: ENSMUSP00000028944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028944]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028944
AA Change: D651V

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028944
Gene: ENSMUSG00000027452
AA Change: D651V

DomainStartEndE-ValueType
low complexity region 4 29 N/A INTRINSIC
Pfam:ACAS_N 51 107 8.6e-17 PFAM
Pfam:AMP-binding 108 549 2.5e-90 PFAM
Pfam:AMP-binding_C 557 635 7.9e-23 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial acetyl-CoA synthetase enzyme. A similar protein in mice plays an important role in the tricarboxylic acid cycle by catalyzing the conversion of acetate to acetyl CoA. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice with disruptions in this gene display abnormalities in acetate metabolism. Ability to maintain body temperature under fasting conditions is reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,756 Y277C probably damaging Het
Aktip G T 8: 91,124,866 P243H possibly damaging Het
Arl11 T G 14: 61,311,265 S175A probably benign Het
Aup1 A G 6: 83,054,607 probably benign Het
Avil A T 10: 127,008,321 I250F probably damaging Het
Btnl6 A T 17: 34,508,883 probably null Het
C77080 A T 4: 129,221,459 V1070D possibly damaging Het
Ccdc7b C A 8: 129,178,291 Q137K probably benign Het
Cdk11b G A 4: 155,639,881 E319K unknown Het
Chka A C 19: 3,885,882 E196A probably damaging Het
Depdc5 C T 5: 32,937,637 R753C probably damaging Het
Dhx57 T A 17: 80,275,156 D340V possibly damaging Het
Dicer1 A T 12: 104,702,693 D1243E probably benign Het
Dnajb9 A T 12: 44,207,133 L164M probably benign Het
Dock6 A G 9: 21,831,444 V785A possibly damaging Het
Efcab5 T C 11: 77,116,071 Y909C probably damaging Het
Erp44 A T 4: 48,208,783 S226T probably benign Het
Fgd6 A T 10: 94,044,052 D256V probably benign Het
Fhl5 A T 4: 25,207,113 Y218* probably null Het
Filip1 C A 9: 79,818,092 A1082S probably benign Het
Gm13088 T A 4: 143,654,185 M423L probably benign Het
Gm13128 A T 4: 144,330,460 D71V probably benign Het
Heatr5a G A 12: 51,891,443 T1484M probably damaging Het
Herc1 G T 9: 66,450,888 R2417L probably damaging Het
Hnrnpr A G 4: 136,317,175 probably benign Het
Igsf5 A T 16: 96,372,988 I73F probably damaging Het
Il17ra T C 6: 120,473,034 V91A probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 K548E probably damaging Het
Kdm5d T A Y: 941,515 C1239S probably damaging Het
Mamdc4 G A 2: 25,566,356 T709M probably benign Het
Mybbp1a T A 11: 72,444,721 Y353N probably damaging Het
Nepn A T 10: 52,391,759 E40D probably benign Het
Npat G T 9: 53,570,570 E1193* probably null Het
Nrde2 G A 12: 100,131,003 S846L probably benign Het
Nup205 T C 6: 35,225,203 V1290A probably benign Het
Olfr1009 T A 2: 85,721,501 L32Q probably null Het
Olfr1424 A G 19: 12,059,092 V220A probably benign Het
Olfr517 C A 7: 108,868,519 V212L probably benign Het
Pde6a A T 18: 61,220,696 K31M possibly damaging Het
Pms2 C T 5: 143,914,771 R169C probably damaging Het
Polr2g A T 19: 8,798,257 L30Q probably damaging Het
Prdm15 T A 16: 97,807,060 H679L probably damaging Het
Prl4a1 T G 13: 28,023,386 Y214* probably null Het
Prlr C T 15: 10,329,242 T601M possibly damaging Het
Psen2 A C 1: 180,245,691 S22A probably benign Het
Ralgapa1 C A 12: 55,722,914 R764L probably damaging Het
Scgb2b11 T C 7: 32,209,408 E89G probably damaging Het
Serpina10 T C 12: 103,628,277 I228V probably benign Het
Serpinb1a T A 13: 32,842,999 H320L probably damaging Het
Sesn2 C A 4: 132,498,053 Q267H possibly damaging Het
Sgsm1 A T 5: 113,251,011 W1019R probably damaging Het
Sqle A G 15: 59,321,302 probably null Het
Syt14 T C 1: 192,986,829 M39V probably benign Het
Tgm7 A G 2: 121,101,064 V206A probably damaging Het
Thbs4 T C 13: 92,760,586 probably null Het
Trpv1 T C 11: 73,254,251 F721S probably damaging Het
Ttll10 A T 4: 156,036,234 M433K probably benign Het
Vmn1r216 T C 13: 23,099,525 I126T probably benign Het
Vmn2r108 G A 17: 20,470,088 S494F probably benign Het
Vwa3b C T 1: 37,128,939 A603V probably benign Het
Xirp2 T A 2: 67,476,866 N19K probably damaging Het
Zfp397 T A 18: 23,960,722 N421K probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Acss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Acss1 APN 2 150619686 missense probably benign 0.27
IGL01594:Acss1 APN 2 150621530 missense probably damaging 0.98
IGL01781:Acss1 APN 2 150637872 missense probably damaging 1.00
IGL02189:Acss1 APN 2 150629868 missense probably damaging 0.98
IGL02735:Acss1 APN 2 150638467 missense probably damaging 1.00
IGL02738:Acss1 APN 2 150624872 splice site probably benign
IGL03399:Acss1 APN 2 150637878 missense probably damaging 1.00
Cutlass UTSW 2 150668131 nonsense probably null
oathkeeper UTSW 2 150659903 missense possibly damaging 0.58
oilseller UTSW 2 150667881 splice site probably null
scimitar UTSW 2 150628492 critical splice donor site probably null
R0058:Acss1 UTSW 2 150628539 missense probably damaging 0.97
R0063:Acss1 UTSW 2 150627292 missense probably damaging 1.00
R0063:Acss1 UTSW 2 150627292 missense probably damaging 1.00
R1550:Acss1 UTSW 2 150642795 missense probably damaging 0.99
R1651:Acss1 UTSW 2 150638437 missense possibly damaging 0.94
R2066:Acss1 UTSW 2 150668131 nonsense probably null
R4414:Acss1 UTSW 2 150659903 missense possibly damaging 0.58
R4559:Acss1 UTSW 2 150638485 missense probably benign 0.19
R4893:Acss1 UTSW 2 150629866 missense probably damaging 0.97
R6408:Acss1 UTSW 2 150628492 critical splice donor site probably null
R6459:Acss1 UTSW 2 150667920 missense probably damaging 0.97
R7593:Acss1 UTSW 2 150619768 nonsense probably null
R7598:Acss1 UTSW 2 150638450 missense probably benign 0.12
R8084:Acss1 UTSW 2 150642781 missense probably damaging 0.99
R8087:Acss1 UTSW 2 150642748 missense probably damaging 1.00
R8143:Acss1 UTSW 2 150667881 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCTTCAGCTTCAAATAGGGC -3'
(R):5'- TCCTCTGTGGGAGTGTCAAC -3'

Sequencing Primer
(F):5'- CTTCAGCTTCAAATAGGGCAGTAG -3'
(R):5'- TGGGAGTGTCAACCTCCACAG -3'
Posted On2020-07-13