Incidental Mutation 'R8213:Fhl5'
ID 636241
Institutional Source Beutler Lab
Gene Symbol Fhl5
Ensembl Gene ENSMUSG00000028259
Gene Name four and a half LIM domains 5
Synonyms 1700027G07Rik, ACT
MMRRC Submission 067655-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R8213 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 25199907-25242852 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 25207113 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 218 (Y218*)
Ref Sequence ENSEMBL: ENSMUSP00000029922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029922] [ENSMUST00000108204]
AlphaFold Q9WTX7
Predicted Effect probably null
Transcript: ENSMUST00000029922
AA Change: Y218*
SMART Domains Protein: ENSMUSP00000029922
Gene: ENSMUSG00000028259
AA Change: Y218*

DomainStartEndE-ValueType
LIM 40 93 1.91e-11 SMART
LIM 101 154 4.59e-14 SMART
LIM 162 213 3.7e-9 SMART
LIM 221 276 7.68e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108204
AA Change: Y218*
SMART Domains Protein: ENSMUSP00000103839
Gene: ENSMUSG00000028259
AA Change: Y218*

DomainStartEndE-ValueType
LIM 40 93 1.91e-11 SMART
LIM 101 154 4.59e-14 SMART
LIM 162 213 3.7e-9 SMART
LIM 221 276 7.68e-16 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is coordinately expressed with activator of cAMP-responsive element modulator (CREM). It is associated with CREM and confers a powerful transcriptional activation function. CREM acts as a transcription factor essential for the differentiation of spermatids into mature spermatozoa. There are multiple polyadenylation sites found in this gene. Polymorphisms in this gene may be associated with susceptibility for migraine headaches. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Apr 2016]
PHENOTYPE: Male mice homozygous for disruptions of this gene have reduced sperm counts and abnormal sperm but are none the less fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,791,605 (GRCm39) Y277C probably damaging Het
Acss1 T A 2: 150,461,630 (GRCm39) D651V possibly damaging Het
Aktip G T 8: 91,851,494 (GRCm39) P243H possibly damaging Het
Arl11 T G 14: 61,548,714 (GRCm39) S175A probably benign Het
Aup1 A G 6: 83,031,588 (GRCm39) probably benign Het
Avil A T 10: 126,844,190 (GRCm39) I250F probably damaging Het
Btnl6 A T 17: 34,727,857 (GRCm39) probably null Het
Ccdc7b C A 8: 129,904,772 (GRCm39) Q137K probably benign Het
Cdk11b G A 4: 155,724,338 (GRCm39) E319K unknown Het
Chka A C 19: 3,935,882 (GRCm39) E196A probably damaging Het
Depdc5 C T 5: 33,094,981 (GRCm39) R753C probably damaging Het
Dhx57 T A 17: 80,582,585 (GRCm39) D340V possibly damaging Het
Dicer1 A T 12: 104,668,952 (GRCm39) D1243E probably benign Het
Dnajb9 A T 12: 44,253,916 (GRCm39) L164M probably benign Het
Dock6 A G 9: 21,742,740 (GRCm39) V785A possibly damaging Het
Efcab5 T C 11: 77,006,897 (GRCm39) Y909C probably damaging Het
Erp44 A T 4: 48,208,783 (GRCm39) S226T probably benign Het
Fgd6 A T 10: 93,879,914 (GRCm39) D256V probably benign Het
Filip1 C A 9: 79,725,374 (GRCm39) A1082S probably benign Het
Heatr5a G A 12: 51,938,226 (GRCm39) T1484M probably damaging Het
Herc1 G T 9: 66,358,170 (GRCm39) R2417L probably damaging Het
Hnrnpr A G 4: 136,044,486 (GRCm39) probably benign Het
Igsf5 A T 16: 96,174,188 (GRCm39) I73F probably damaging Het
Il17ra T C 6: 120,449,995 (GRCm39) V91A probably benign Het
Inpp5f A G 7: 128,281,529 (GRCm39) D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 (GRCm39) K548E probably damaging Het
Kdm5d T A Y: 941,515 (GRCm39) C1239S probably damaging Het
Mamdc4 G A 2: 25,456,368 (GRCm39) T709M probably benign Het
Mybbp1a T A 11: 72,335,547 (GRCm39) Y353N probably damaging Het
Nepn A T 10: 52,267,855 (GRCm39) E40D probably benign Het
Nhsl3 A T 4: 129,115,252 (GRCm39) V1070D possibly damaging Het
Npat G T 9: 53,481,870 (GRCm39) E1193* probably null Het
Nrde2 G A 12: 100,097,262 (GRCm39) S846L probably benign Het
Nup205 T C 6: 35,202,138 (GRCm39) V1290A probably benign Het
Or10a49 C A 7: 108,467,726 (GRCm39) V212L probably benign Het
Or4d10b A G 19: 12,036,456 (GRCm39) V220A probably benign Het
Or5g9 T A 2: 85,551,845 (GRCm39) L32Q probably null Het
Pde6a A T 18: 61,353,768 (GRCm39) K31M possibly damaging Het
Pms2 C T 5: 143,851,589 (GRCm39) R169C probably damaging Het
Polr2g A T 19: 8,775,621 (GRCm39) L30Q probably damaging Het
Pramel22 T A 4: 143,380,755 (GRCm39) M423L probably benign Het
Pramel30 A T 4: 144,057,030 (GRCm39) D71V probably benign Het
Prdm15 T A 16: 97,608,260 (GRCm39) H679L probably damaging Het
Prl4a1 T G 13: 28,207,369 (GRCm39) Y214* probably null Het
Prlr C T 15: 10,329,328 (GRCm39) T601M possibly damaging Het
Psen2 A C 1: 180,073,256 (GRCm39) S22A probably benign Het
Ralgapa1 C A 12: 55,769,699 (GRCm39) R764L probably damaging Het
Scgb2b11 T C 7: 31,908,833 (GRCm39) E89G probably damaging Het
Serpina10 T C 12: 103,594,536 (GRCm39) I228V probably benign Het
Serpinb1a T A 13: 33,026,982 (GRCm39) H320L probably damaging Het
Sesn2 C A 4: 132,225,364 (GRCm39) Q267H possibly damaging Het
Sgsm1 A T 5: 113,398,877 (GRCm39) W1019R probably damaging Het
Sqle A G 15: 59,193,151 (GRCm39) probably null Het
Syt14 T C 1: 192,669,137 (GRCm39) M39V probably benign Het
Tgm7 A G 2: 120,931,545 (GRCm39) V206A probably damaging Het
Thbs4 T C 13: 92,897,094 (GRCm39) probably null Het
Trpv1 T C 11: 73,145,077 (GRCm39) F721S probably damaging Het
Ttll10 A T 4: 156,120,691 (GRCm39) M433K probably benign Het
Vmn1r216 T C 13: 23,283,695 (GRCm39) I126T probably benign Het
Vmn2r108 G A 17: 20,690,350 (GRCm39) S494F probably benign Het
Vwa3b C T 1: 37,168,020 (GRCm39) A603V probably benign Het
Xirp2 T A 2: 67,307,210 (GRCm39) N19K probably damaging Het
Zfp397 T A 18: 24,093,779 (GRCm39) N421K probably damaging Het
Zscan5b C T 7: 6,236,946 (GRCm39) P232S possibly damaging Het
Other mutations in Fhl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Fhl5 APN 4 25,207,181 (GRCm39) missense possibly damaging 0.95
IGL02194:Fhl5 APN 4 25,211,341 (GRCm39) missense probably benign 0.01
IGL03172:Fhl5 APN 4 25,211,309 (GRCm39) missense probably damaging 1.00
PIT4466001:Fhl5 UTSW 4 25,211,194 (GRCm39) missense probably damaging 1.00
PIT4472001:Fhl5 UTSW 4 25,211,194 (GRCm39) missense probably damaging 1.00
R0020:Fhl5 UTSW 4 25,200,054 (GRCm39) missense probably benign 0.15
R0020:Fhl5 UTSW 4 25,200,054 (GRCm39) missense probably benign 0.15
R0256:Fhl5 UTSW 4 25,213,624 (GRCm39) missense probably benign
R0304:Fhl5 UTSW 4 25,207,241 (GRCm39) missense probably benign 0.01
R0480:Fhl5 UTSW 4 25,207,101 (GRCm39) nonsense probably null
R0563:Fhl5 UTSW 4 25,213,610 (GRCm39) missense probably damaging 0.96
R3418:Fhl5 UTSW 4 25,211,252 (GRCm39) missense probably benign
R3926:Fhl5 UTSW 4 25,214,790 (GRCm39) splice site probably benign
R4382:Fhl5 UTSW 4 25,200,118 (GRCm39) missense probably benign 0.16
R5930:Fhl5 UTSW 4 25,214,756 (GRCm39) missense probably benign 0.04
R6135:Fhl5 UTSW 4 25,214,716 (GRCm39) nonsense probably null
R6927:Fhl5 UTSW 4 25,213,681 (GRCm39) missense probably benign 0.14
R7147:Fhl5 UTSW 4 25,213,777 (GRCm39) critical splice acceptor site probably null
R7975:Fhl5 UTSW 4 25,214,730 (GRCm39) missense probably benign
R9609:Fhl5 UTSW 4 25,214,653 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCATTTCCTTGAGAGGGCC -3'
(R):5'- TTGAGATTGTCTGAACTACAAGGG -3'

Sequencing Primer
(F):5'- CCTTGAGAGGGCCATGTAAAATTTAG -3'
(R):5'- GGTACCCATGCTCATTGCC -3'
Posted On 2020-07-13