Incidental Mutation 'R8213:Nhsl3'
ID 636243
Institutional Source Beutler Lab
Gene Symbol Nhsl3
Ensembl Gene ENSMUSG00000050390
Gene Name NHS like 3
Synonyms C77080
MMRRC Submission 067655-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.144) question?
Stock # R8213 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 129113371-129155194 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 129115252 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 1070 (V1070D)
Ref Sequence ENSEMBL: ENSMUSP00000062395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052602] [ENSMUST00000097873] [ENSMUST00000106051] [ENSMUST00000106054] [ENSMUST00000145261] [ENSMUST00000146376]
AlphaFold A2A7S8
Predicted Effect possibly damaging
Transcript: ENSMUST00000052602
AA Change: V1070D

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000062395
Gene: ENSMUSG00000050390
AA Change: V1070D

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 39 80 N/A INTRINSIC
low complexity region 209 215 N/A INTRINSIC
low complexity region 273 286 N/A INTRINSIC
low complexity region 365 382 N/A INTRINSIC
low complexity region 393 418 N/A INTRINSIC
low complexity region 449 464 N/A INTRINSIC
low complexity region 492 499 N/A INTRINSIC
low complexity region 532 550 N/A INTRINSIC
low complexity region 555 588 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 657 690 N/A INTRINSIC
low complexity region 724 739 N/A INTRINSIC
low complexity region 743 773 N/A INTRINSIC
low complexity region 810 833 N/A INTRINSIC
low complexity region 916 930 N/A INTRINSIC
low complexity region 988 1020 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097873
AA Change: V1025D

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095483
Gene: ENSMUSG00000050390
AA Change: V1025D

DomainStartEndE-ValueType
low complexity region 164 170 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 348 373 N/A INTRINSIC
low complexity region 404 419 N/A INTRINSIC
low complexity region 447 454 N/A INTRINSIC
low complexity region 487 505 N/A INTRINSIC
low complexity region 510 543 N/A INTRINSIC
low complexity region 576 589 N/A INTRINSIC
low complexity region 612 645 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
low complexity region 698 728 N/A INTRINSIC
low complexity region 765 788 N/A INTRINSIC
low complexity region 871 885 N/A INTRINSIC
low complexity region 943 975 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106051
AA Change: V1013D

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101666
Gene: ENSMUSG00000050390
AA Change: V1013D

DomainStartEndE-ValueType
low complexity region 152 158 N/A INTRINSIC
low complexity region 216 229 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 336 361 N/A INTRINSIC
low complexity region 392 407 N/A INTRINSIC
low complexity region 435 442 N/A INTRINSIC
low complexity region 475 493 N/A INTRINSIC
low complexity region 498 531 N/A INTRINSIC
low complexity region 564 577 N/A INTRINSIC
low complexity region 600 633 N/A INTRINSIC
low complexity region 667 682 N/A INTRINSIC
low complexity region 686 716 N/A INTRINSIC
low complexity region 753 776 N/A INTRINSIC
low complexity region 859 873 N/A INTRINSIC
low complexity region 931 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106054
SMART Domains Protein: ENSMUSP00000101669
Gene: ENSMUSG00000028811

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:tRNA-synt_1b 67 358 1e-78 PFAM
Pfam:tRNA_bind 406 502 7.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145261
Predicted Effect probably benign
Transcript: ENSMUST00000146376
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,791,605 (GRCm39) Y277C probably damaging Het
Acss1 T A 2: 150,461,630 (GRCm39) D651V possibly damaging Het
Aktip G T 8: 91,851,494 (GRCm39) P243H possibly damaging Het
Arl11 T G 14: 61,548,714 (GRCm39) S175A probably benign Het
Aup1 A G 6: 83,031,588 (GRCm39) probably benign Het
Avil A T 10: 126,844,190 (GRCm39) I250F probably damaging Het
Btnl6 A T 17: 34,727,857 (GRCm39) probably null Het
Ccdc7b C A 8: 129,904,772 (GRCm39) Q137K probably benign Het
Cdk11b G A 4: 155,724,338 (GRCm39) E319K unknown Het
Chka A C 19: 3,935,882 (GRCm39) E196A probably damaging Het
Depdc5 C T 5: 33,094,981 (GRCm39) R753C probably damaging Het
Dhx57 T A 17: 80,582,585 (GRCm39) D340V possibly damaging Het
Dicer1 A T 12: 104,668,952 (GRCm39) D1243E probably benign Het
Dnajb9 A T 12: 44,253,916 (GRCm39) L164M probably benign Het
Dock6 A G 9: 21,742,740 (GRCm39) V785A possibly damaging Het
Efcab5 T C 11: 77,006,897 (GRCm39) Y909C probably damaging Het
Erp44 A T 4: 48,208,783 (GRCm39) S226T probably benign Het
Fgd6 A T 10: 93,879,914 (GRCm39) D256V probably benign Het
Fhl5 A T 4: 25,207,113 (GRCm39) Y218* probably null Het
Filip1 C A 9: 79,725,374 (GRCm39) A1082S probably benign Het
Heatr5a G A 12: 51,938,226 (GRCm39) T1484M probably damaging Het
Herc1 G T 9: 66,358,170 (GRCm39) R2417L probably damaging Het
Hnrnpr A G 4: 136,044,486 (GRCm39) probably benign Het
Igsf5 A T 16: 96,174,188 (GRCm39) I73F probably damaging Het
Il17ra T C 6: 120,449,995 (GRCm39) V91A probably benign Het
Inpp5f A G 7: 128,281,529 (GRCm39) D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 (GRCm39) K548E probably damaging Het
Kdm5d T A Y: 941,515 (GRCm39) C1239S probably damaging Het
Mamdc4 G A 2: 25,456,368 (GRCm39) T709M probably benign Het
Mybbp1a T A 11: 72,335,547 (GRCm39) Y353N probably damaging Het
Nepn A T 10: 52,267,855 (GRCm39) E40D probably benign Het
Npat G T 9: 53,481,870 (GRCm39) E1193* probably null Het
Nrde2 G A 12: 100,097,262 (GRCm39) S846L probably benign Het
Nup205 T C 6: 35,202,138 (GRCm39) V1290A probably benign Het
Or10a49 C A 7: 108,467,726 (GRCm39) V212L probably benign Het
Or4d10b A G 19: 12,036,456 (GRCm39) V220A probably benign Het
Or5g9 T A 2: 85,551,845 (GRCm39) L32Q probably null Het
Pde6a A T 18: 61,353,768 (GRCm39) K31M possibly damaging Het
Pms2 C T 5: 143,851,589 (GRCm39) R169C probably damaging Het
Polr2g A T 19: 8,775,621 (GRCm39) L30Q probably damaging Het
Pramel22 T A 4: 143,380,755 (GRCm39) M423L probably benign Het
Pramel30 A T 4: 144,057,030 (GRCm39) D71V probably benign Het
Prdm15 T A 16: 97,608,260 (GRCm39) H679L probably damaging Het
Prl4a1 T G 13: 28,207,369 (GRCm39) Y214* probably null Het
Prlr C T 15: 10,329,328 (GRCm39) T601M possibly damaging Het
Psen2 A C 1: 180,073,256 (GRCm39) S22A probably benign Het
Ralgapa1 C A 12: 55,769,699 (GRCm39) R764L probably damaging Het
Scgb2b11 T C 7: 31,908,833 (GRCm39) E89G probably damaging Het
Serpina10 T C 12: 103,594,536 (GRCm39) I228V probably benign Het
Serpinb1a T A 13: 33,026,982 (GRCm39) H320L probably damaging Het
Sesn2 C A 4: 132,225,364 (GRCm39) Q267H possibly damaging Het
Sgsm1 A T 5: 113,398,877 (GRCm39) W1019R probably damaging Het
Sqle A G 15: 59,193,151 (GRCm39) probably null Het
Syt14 T C 1: 192,669,137 (GRCm39) M39V probably benign Het
Tgm7 A G 2: 120,931,545 (GRCm39) V206A probably damaging Het
Thbs4 T C 13: 92,897,094 (GRCm39) probably null Het
Trpv1 T C 11: 73,145,077 (GRCm39) F721S probably damaging Het
Ttll10 A T 4: 156,120,691 (GRCm39) M433K probably benign Het
Vmn1r216 T C 13: 23,283,695 (GRCm39) I126T probably benign Het
Vmn2r108 G A 17: 20,690,350 (GRCm39) S494F probably benign Het
Vwa3b C T 1: 37,168,020 (GRCm39) A603V probably benign Het
Xirp2 T A 2: 67,307,210 (GRCm39) N19K probably damaging Het
Zfp397 T A 18: 24,093,779 (GRCm39) N421K probably damaging Het
Zscan5b C T 7: 6,236,946 (GRCm39) P232S possibly damaging Het
Other mutations in Nhsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Nhsl3 APN 4 129,116,589 (GRCm39) splice site probably null
IGL02654:Nhsl3 APN 4 129,116,112 (GRCm39) missense probably damaging 1.00
IGL02797:Nhsl3 APN 4 129,117,104 (GRCm39) missense probably damaging 0.99
IGL03231:Nhsl3 APN 4 129,117,474 (GRCm39) missense possibly damaging 0.73
IGL03134:Nhsl3 UTSW 4 129,116,280 (GRCm39) missense possibly damaging 0.53
R0078:Nhsl3 UTSW 4 129,121,516 (GRCm39) splice site probably null
R0418:Nhsl3 UTSW 4 129,117,477 (GRCm39) missense probably damaging 1.00
R1374:Nhsl3 UTSW 4 129,116,082 (GRCm39) missense possibly damaging 0.83
R1632:Nhsl3 UTSW 4 129,116,459 (GRCm39) missense possibly damaging 0.94
R1735:Nhsl3 UTSW 4 129,117,370 (GRCm39) missense probably damaging 1.00
R1970:Nhsl3 UTSW 4 129,119,810 (GRCm39) splice site probably benign
R2018:Nhsl3 UTSW 4 129,116,148 (GRCm39) missense probably damaging 0.96
R2157:Nhsl3 UTSW 4 129,117,917 (GRCm39) missense possibly damaging 0.76
R2201:Nhsl3 UTSW 4 129,116,432 (GRCm39) missense probably benign
R2316:Nhsl3 UTSW 4 129,117,540 (GRCm39) missense probably damaging 1.00
R3751:Nhsl3 UTSW 4 129,118,115 (GRCm39) unclassified probably benign
R4648:Nhsl3 UTSW 4 129,115,733 (GRCm39) missense probably benign 0.00
R4790:Nhsl3 UTSW 4 129,117,095 (GRCm39) missense probably damaging 1.00
R4885:Nhsl3 UTSW 4 129,118,238 (GRCm39) missense probably damaging 1.00
R5217:Nhsl3 UTSW 4 129,116,478 (GRCm39) missense probably damaging 0.99
R5270:Nhsl3 UTSW 4 129,118,005 (GRCm39) missense possibly damaging 0.48
R5272:Nhsl3 UTSW 4 129,118,005 (GRCm39) missense possibly damaging 0.48
R5273:Nhsl3 UTSW 4 129,118,005 (GRCm39) missense possibly damaging 0.48
R5314:Nhsl3 UTSW 4 129,118,005 (GRCm39) missense possibly damaging 0.48
R5548:Nhsl3 UTSW 4 129,117,773 (GRCm39) frame shift probably null
R5752:Nhsl3 UTSW 4 129,117,773 (GRCm39) frame shift probably null
R5908:Nhsl3 UTSW 4 129,115,941 (GRCm39) missense probably damaging 0.98
R5960:Nhsl3 UTSW 4 129,115,865 (GRCm39) missense probably damaging 0.99
R7024:Nhsl3 UTSW 4 129,119,201 (GRCm39) missense probably null 0.73
R7296:Nhsl3 UTSW 4 129,119,211 (GRCm39) missense probably damaging 1.00
R7447:Nhsl3 UTSW 4 129,115,835 (GRCm39) missense possibly damaging 0.63
R7638:Nhsl3 UTSW 4 129,115,734 (GRCm39) missense probably benign
R7689:Nhsl3 UTSW 4 129,117,566 (GRCm39) missense probably benign 0.25
R7819:Nhsl3 UTSW 4 129,116,276 (GRCm39) missense probably benign 0.31
R8219:Nhsl3 UTSW 4 129,141,946 (GRCm39) missense possibly damaging 0.55
R8348:Nhsl3 UTSW 4 129,117,699 (GRCm39) missense probably damaging 1.00
R8360:Nhsl3 UTSW 4 129,117,995 (GRCm39) missense possibly damaging 0.89
R8788:Nhsl3 UTSW 4 129,119,743 (GRCm39) missense probably benign
R9252:Nhsl3 UTSW 4 129,117,269 (GRCm39) missense probably benign 0.01
R9652:Nhsl3 UTSW 4 129,117,962 (GRCm39) missense possibly damaging 0.90
Z1088:Nhsl3 UTSW 4 129,116,091 (GRCm39) missense probably damaging 1.00
Z1176:Nhsl3 UTSW 4 129,117,497 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGAATCCTTTCAGGCAAAG -3'
(R):5'- CACTTAGGTTTAAAATGGGGCGG -3'

Sequencing Primer
(F):5'- GTCACTTGGAGGATGGGCAAC -3'
(R):5'- TTTAAAATGGGGCGGAGACACC -3'
Posted On 2020-07-13