Incidental Mutation 'R8213:Hnrnpr'
ID636245
Institutional Source Beutler Lab
Gene Symbol Hnrnpr
Ensembl Gene ENSMUSG00000066037
Gene Nameheterogeneous nuclear ribonucleoprotein R
SynonymshnRNPR, Hnrpr, 2610528B01Rik, 2610003J05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8213 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location136310942-136359447 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 136317175 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084219] [ENSMUST00000105850] [ENSMUST00000125696] [ENSMUST00000131671] [ENSMUST00000134524] [ENSMUST00000145282] [ENSMUST00000148843] [ENSMUST00000156259]
Predicted Effect probably damaging
Transcript: ENSMUST00000084219
AA Change: D22G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081239
Gene: ENSMUSG00000066037
AA Change: D22G

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105850
AA Change: D123G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101476
Gene: ENSMUSG00000066037
AA Change: D123G

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125696
AA Change: D22G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000131671
AA Change: D22G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138263
Gene: ENSMUSG00000066037
AA Change: D22G

DomainStartEndE-ValueType
RRM 65 139 1.27e-16 SMART
RRM 146 223 9.42e-11 SMART
RRM 241 306 3.76e-19 SMART
low complexity region 318 327 N/A INTRINSIC
low complexity region 332 395 N/A INTRINSIC
low complexity region 398 426 N/A INTRINSIC
low complexity region 430 473 N/A INTRINSIC
low complexity region 503 519 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134524
AA Change: D123G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119666
Gene: ENSMUSG00000066037
AA Change: D123G

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145282
Predicted Effect probably damaging
Transcript: ENSMUST00000148843
AA Change: D123G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138399
Gene: ENSMUSG00000066037
AA Change: D123G

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156259
Meta Mutation Damage Score 0.1775 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is a member of the spliceosome C complex, which functions in pre-mRNA processing and transport. The encoded protein also promotes transcription at the c-fos gene. Alternative splicing results in multiple transcript variants. There are pseudogenes for this gene on chromosomes 4, 11, and 10. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,756 Y277C probably damaging Het
Acss1 T A 2: 150,619,710 D651V possibly damaging Het
Aktip G T 8: 91,124,866 P243H possibly damaging Het
Arl11 T G 14: 61,311,265 S175A probably benign Het
Aup1 A G 6: 83,054,607 probably benign Het
Avil A T 10: 127,008,321 I250F probably damaging Het
Btnl6 A T 17: 34,508,883 probably null Het
C77080 A T 4: 129,221,459 V1070D possibly damaging Het
Ccdc7b C A 8: 129,178,291 Q137K probably benign Het
Cdk11b G A 4: 155,639,881 E319K unknown Het
Chka A C 19: 3,885,882 E196A probably damaging Het
Depdc5 C T 5: 32,937,637 R753C probably damaging Het
Dhx57 T A 17: 80,275,156 D340V possibly damaging Het
Dicer1 A T 12: 104,702,693 D1243E probably benign Het
Dnajb9 A T 12: 44,207,133 L164M probably benign Het
Dock6 A G 9: 21,831,444 V785A possibly damaging Het
Efcab5 T C 11: 77,116,071 Y909C probably damaging Het
Erp44 A T 4: 48,208,783 S226T probably benign Het
Fgd6 A T 10: 94,044,052 D256V probably benign Het
Fhl5 A T 4: 25,207,113 Y218* probably null Het
Filip1 C A 9: 79,818,092 A1082S probably benign Het
Gm13088 T A 4: 143,654,185 M423L probably benign Het
Gm13128 A T 4: 144,330,460 D71V probably benign Het
Heatr5a G A 12: 51,891,443 T1484M probably damaging Het
Herc1 G T 9: 66,450,888 R2417L probably damaging Het
Igsf5 A T 16: 96,372,988 I73F probably damaging Het
Il17ra T C 6: 120,473,034 V91A probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 K548E probably damaging Het
Kdm5d T A Y: 941,515 C1239S probably damaging Het
Mamdc4 G A 2: 25,566,356 T709M probably benign Het
Mybbp1a T A 11: 72,444,721 Y353N probably damaging Het
Nepn A T 10: 52,391,759 E40D probably benign Het
Npat G T 9: 53,570,570 E1193* probably null Het
Nrde2 G A 12: 100,131,003 S846L probably benign Het
Nup205 T C 6: 35,225,203 V1290A probably benign Het
Olfr1009 T A 2: 85,721,501 L32Q probably null Het
Olfr1424 A G 19: 12,059,092 V220A probably benign Het
Olfr517 C A 7: 108,868,519 V212L probably benign Het
Pde6a A T 18: 61,220,696 K31M possibly damaging Het
Pms2 C T 5: 143,914,771 R169C probably damaging Het
Polr2g A T 19: 8,798,257 L30Q probably damaging Het
Prdm15 T A 16: 97,807,060 H679L probably damaging Het
Prl4a1 T G 13: 28,023,386 Y214* probably null Het
Prlr C T 15: 10,329,242 T601M possibly damaging Het
Psen2 A C 1: 180,245,691 S22A probably benign Het
Ralgapa1 C A 12: 55,722,914 R764L probably damaging Het
Scgb2b11 T C 7: 32,209,408 E89G probably damaging Het
Serpina10 T C 12: 103,628,277 I228V probably benign Het
Serpinb1a T A 13: 32,842,999 H320L probably damaging Het
Sesn2 C A 4: 132,498,053 Q267H possibly damaging Het
Sgsm1 A T 5: 113,251,011 W1019R probably damaging Het
Sqle A G 15: 59,321,302 probably null Het
Syt14 T C 1: 192,986,829 M39V probably benign Het
Tgm7 A G 2: 121,101,064 V206A probably damaging Het
Thbs4 T C 13: 92,760,586 probably null Het
Trpv1 T C 11: 73,254,251 F721S probably damaging Het
Ttll10 A T 4: 156,036,234 M433K probably benign Het
Vmn1r216 T C 13: 23,099,525 I126T probably benign Het
Vmn2r108 G A 17: 20,470,088 S494F probably benign Het
Vwa3b C T 1: 37,128,939 A603V probably benign Het
Xirp2 T A 2: 67,476,866 N19K probably damaging Het
Zfp397 T A 18: 23,960,722 N421K probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Hnrnpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Hnrnpr APN 4 136339545 missense unknown
IGL00844:Hnrnpr APN 4 136339205 missense probably benign 0.17
IGL01374:Hnrnpr APN 4 136327418 splice site probably benign
IGL01704:Hnrnpr APN 4 136329381 missense possibly damaging 0.89
IGL01825:Hnrnpr APN 4 136339539 nonsense probably null
IGL01843:Hnrnpr APN 4 136339413 splice site probably benign
IGL01871:Hnrnpr APN 4 136339574 missense unknown
IGL02376:Hnrnpr APN 4 136319455 missense probably damaging 1.00
IGL02557:Hnrnpr APN 4 136319506 missense probably damaging 1.00
IGL02947:Hnrnpr APN 4 136316379 missense probably damaging 1.00
PIT4677001:Hnrnpr UTSW 4 136329439 missense probably damaging 1.00
R0142:Hnrnpr UTSW 4 136327282 missense probably damaging 1.00
R0219:Hnrnpr UTSW 4 136339163 splice site probably benign
R1459:Hnrnpr UTSW 4 136329444 missense probably damaging 1.00
R1917:Hnrnpr UTSW 4 136332488 nonsense probably null
R2007:Hnrnpr UTSW 4 136319513 unclassified probably benign
R2364:Hnrnpr UTSW 4 136327329 missense possibly damaging 0.69
R3788:Hnrnpr UTSW 4 136336313 missense probably damaging 1.00
R4066:Hnrnpr UTSW 4 136339346 intron probably benign
R4232:Hnrnpr UTSW 4 136339189 missense probably benign 0.15
R4433:Hnrnpr UTSW 4 136317148 missense probably benign 0.04
R4664:Hnrnpr UTSW 4 136317175 unclassified probably benign
R4990:Hnrnpr UTSW 4 136329379 missense probably damaging 1.00
R4990:Hnrnpr UTSW 4 136336298 missense probably damaging 1.00
R5058:Hnrnpr UTSW 4 136336337 missense possibly damaging 0.89
R5328:Hnrnpr UTSW 4 136339216 missense probably benign 0.01
R5469:Hnrnpr UTSW 4 136319434 missense probably damaging 1.00
R5641:Hnrnpr UTSW 4 136332487 missense probably damaging 0.97
R7067:Hnrnpr UTSW 4 136327393 missense probably damaging 1.00
R7250:Hnrnpr UTSW 4 136332435 missense probably benign 0.45
R7254:Hnrnpr UTSW 4 136332575 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GACTTACTGTCTGCTCCAGC -3'
(R):5'- TTAGAATACCACAGCTCTTCCCTAAG -3'

Sequencing Primer
(F):5'- CCTCAGGCATGTCAAAGTATTTG -3'
(R):5'- CCAGGCCAGTTTGAGCTACATAATG -3'
Posted On2020-07-13