Mutagenetix > Incidental Mutation

Incidental Mutation 'R8213:Gm13088'

636246

Institutional Source

Beutler Lab

Gene Symbol

Gm13088

Ensembl Gene

ENSMUSG00000078513

Gene Name

predicted gene 13088

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.052) question?

Stock #

R8213 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

143653760-143657246 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 143654185 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 423 (M423L)

Ref Sequence

ENSEMBL: ENSMUSP00000101397 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105771]

AlphaFold

A2AGW6

Predicted Effect

probably benign
Transcript: ENSMUST00000105771
AA Change: M423L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000101397
Gene: ENSMUSG00000078513
AA Change: M423L

Domain	Start	End	E-Value	Type
low complexity region	188	202	N/A	INTRINSIC
low complexity region	372	391	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.1%

Validation Efficiency

98% (65/66)

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	C	15: 60,919,756	Y277C	probably damaging	Het
Acss1	T	A	2: 150,619,710	D651V	possibly damaging	Het
Aktip	G	T	8: 91,124,866	P243H	possibly damaging	Het
Arl11	T	G	14: 61,311,265	S175A	probably benign	Het
Aup1	A	G	6: 83,054,607		probably benign	Het
Avil	A	T	10: 127,008,321	I250F	probably damaging	Het
Btnl6	A	T	17: 34,508,883		probably null	Het
C77080	A	T	4: 129,221,459	V1070D	possibly damaging	Het
Ccdc7b	C	A	8: 129,178,291	Q137K	probably benign	Het
Cdk11b	G	A	4: 155,639,881	E319K	unknown	Het
Chka	A	C	19: 3,885,882	E196A	probably damaging	Het
Depdc5	C	T	5: 32,937,637	R753C	probably damaging	Het
Dhx57	T	A	17: 80,275,156	D340V	possibly damaging	Het
Dicer1	A	T	12: 104,702,693	D1243E	probably benign	Het
Dnajb9	A	T	12: 44,207,133	L164M	probably benign	Het
Dock6	A	G	9: 21,831,444	V785A	possibly damaging	Het
Efcab5	T	C	11: 77,116,071	Y909C	probably damaging	Het
Erp44	A	T	4: 48,208,783	S226T	probably benign	Het
Fgd6	A	T	10: 94,044,052	D256V	probably benign	Het
Fhl5	A	T	4: 25,207,113	Y218*	probably null	Het
Filip1	C	A	9: 79,818,092	A1082S	probably benign	Het
Gm13128	A	T	4: 144,330,460	D71V	probably benign	Het
Heatr5a	G	A	12: 51,891,443	T1484M	probably damaging	Het
Herc1	G	T	9: 66,450,888	R2417L	probably damaging	Het
Hnrnpr	A	G	4: 136,317,175		probably benign	Het
Igsf5	A	T	16: 96,372,988	I73F	probably damaging	Het
Il17ra	T	C	6: 120,473,034	V91A	probably benign	Het
Inpp5f	A	G	7: 128,679,805	D510G	probably damaging	Het
Kbtbd3	A	G	9: 4,331,269	K548E	probably damaging	Het
Kdm5d	T	A	Y: 941,515	C1239S	probably damaging	Het
Mamdc4	G	A	2: 25,566,356	T709M	probably benign	Het
Mybbp1a	T	A	11: 72,444,721	Y353N	probably damaging	Het
Nepn	A	T	10: 52,391,759	E40D	probably benign	Het
Npat	G	T	9: 53,570,570	E1193*	probably null	Het
Nrde2	G	A	12: 100,131,003	S846L	probably benign	Het
Nup205	T	C	6: 35,225,203	V1290A	probably benign	Het
Olfr1009	T	A	2: 85,721,501	L32Q	probably null	Het
Olfr1424	A	G	19: 12,059,092	V220A	probably benign	Het
Olfr517	C	A	7: 108,868,519	V212L	probably benign	Het
Pde6a	A	T	18: 61,220,696	K31M	possibly damaging	Het
Pms2	C	T	5: 143,914,771	R169C	probably damaging	Het
Polr2g	A	T	19: 8,798,257	L30Q	probably damaging	Het
Prdm15	T	A	16: 97,807,060	H679L	probably damaging	Het
Prl4a1	T	G	13: 28,023,386	Y214*	probably null	Het
Prlr	C	T	15: 10,329,242	T601M	possibly damaging	Het
Psen2	A	C	1: 180,245,691	S22A	probably benign	Het
Ralgapa1	C	A	12: 55,722,914	R764L	probably damaging	Het
Scgb2b11	T	C	7: 32,209,408	E89G	probably damaging	Het
Serpina10	T	C	12: 103,628,277	I228V	probably benign	Het
Serpinb1a	T	A	13: 32,842,999	H320L	probably damaging	Het
Sesn2	C	A	4: 132,498,053	Q267H	possibly damaging	Het
Sgsm1	A	T	5: 113,251,011	W1019R	probably damaging	Het
Sqle	A	G	15: 59,321,302		probably null	Het
Syt14	T	C	1: 192,986,829	M39V	probably benign	Het
Tgm7	A	G	2: 121,101,064	V206A	probably damaging	Het
Thbs4	T	C	13: 92,760,586		probably null	Het
Trpv1	T	C	11: 73,254,251	F721S	probably damaging	Het
Ttll10	A	T	4: 156,036,234	M433K	probably benign	Het
Vmn1r216	T	C	13: 23,099,525	I126T	probably benign	Het
Vmn2r108	G	A	17: 20,470,088	S494F	probably benign	Het
Vwa3b	C	T	1: 37,128,939	A603V	probably benign	Het
Xirp2	T	A	2: 67,476,866	N19K	probably damaging	Het
Zfp397	T	A	18: 23,960,722	N421K	probably damaging	Het
Zscan5b	C	T	7: 6,233,947	P232S	possibly damaging	Het

Other mutations in Gm13088

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01413:Gm13088	APN	4	143655317	missense	probably benign	0.00
IGL01418:Gm13088	APN	4	143655317	missense	probably benign	0.00
IGL01551:Gm13088	APN	4	143656472	missense	probably damaging	0.99
IGL02016:Gm13088	APN	4	143655319	missense	possibly damaging	0.52
IGL02157:Gm13088	APN	4	143654377	missense	probably damaging	1.00
IGL02433:Gm13088	APN	4	143655437	missense	possibly damaging	0.92
IGL02726:Gm13088	APN	4	143655385	missense	probably damaging	1.00
IGL02900:Gm13088	APN	4	143655515	missense	possibly damaging	0.59
IGL03367:Gm13088	APN	4	143655623	missense	possibly damaging	0.46
IGL02835:Gm13088	UTSW	4	143654247	missense	probably damaging	1.00
R0141:Gm13088	UTSW	4	143654568	missense	probably benign	0.01
R0166:Gm13088	UTSW	4	143654511	missense	probably benign	0.00
R0197:Gm13088	UTSW	4	143656440	missense	possibly damaging	0.76
R0365:Gm13088	UTSW	4	143655501	nonsense	probably null
R0427:Gm13088	UTSW	4	143654423	missense	probably benign	0.00
R0701:Gm13088	UTSW	4	143656440	missense	possibly damaging	0.76
R0927:Gm13088	UTSW	4	143654220	missense	possibly damaging	0.84
R1103:Gm13088	UTSW	4	143655372	missense	probably damaging	1.00
R1163:Gm13088	UTSW	4	143656634	missense	probably damaging	1.00
R1565:Gm13088	UTSW	4	143655617	nonsense	probably null
R1588:Gm13088	UTSW	4	143655551	missense	probably damaging	1.00
R1669:Gm13088	UTSW	4	143654346	missense	possibly damaging	0.53
R1925:Gm13088	UTSW	4	143654455	missense	probably damaging	1.00
R1929:Gm13088	UTSW	4	143654142	missense	probably damaging	1.00
R1990:Gm13088	UTSW	4	143654268	missense	probably damaging	1.00
R2272:Gm13088	UTSW	4	143654142	missense	probably damaging	1.00
R2845:Gm13088	UTSW	4	143654298	missense	probably damaging	0.99
R3819:Gm13088	UTSW	4	143655795	missense	probably benign	0.02
R4660:Gm13088	UTSW	4	143654277	missense	probably benign	0.01
R4857:Gm13088	UTSW	4	143656588	missense	possibly damaging	0.65
R4888:Gm13088	UTSW	4	143654401	missense	probably benign	0.33
R5004:Gm13088	UTSW	4	143654136	missense	probably benign
R5242:Gm13088	UTSW	4	143655611	missense	probably benign	0.38
R5246:Gm13088	UTSW	4	143655557	missense	probably benign	0.00
R5596:Gm13088	UTSW	4	143654455	missense	probably damaging	1.00
R5735:Gm13088	UTSW	4	143654635	missense	probably damaging	1.00
R5841:Gm13088	UTSW	4	143655539	missense	possibly damaging	0.95
R5982:Gm13088	UTSW	4	143654464	missense	probably damaging	0.99
R6052:Gm13088	UTSW	4	143655652	missense	probably damaging	1.00
R6169:Gm13088	UTSW	4	143654115	missense	probably benign	0.04
R6403:Gm13088	UTSW	4	143655773	nonsense	probably null
R6584:Gm13088	UTSW	4	143655470	missense	possibly damaging	0.74
R6898:Gm13088	UTSW	4	143655483	missense	probably damaging	1.00
R7438:Gm13088	UTSW	4	143655560	missense	probably damaging	0.96
R7563:Gm13088	UTSW	4	143654105	nonsense	probably null
R7674:Gm13088	UTSW	4	143655605	nonsense	probably null
R7792:Gm13088	UTSW	4	143654553	missense	probably benign	0.00
R7796:Gm13088	UTSW	4	143654157	missense	possibly damaging	0.57
R7915:Gm13088	UTSW	4	143655745	missense	possibly damaging	0.94
R7921:Gm13088	UTSW	4	143656565	missense	probably damaging	0.97
R8419:Gm13088	UTSW	4	143656427	missense	probably damaging	0.99
R8813:Gm13088	UTSW	4	143654343	missense	probably damaging	1.00
R8844:Gm13088	UTSW	4	143654406	missense	probably damaging	0.99
R8893:Gm13088	UTSW	4	143655490	missense	probably damaging	1.00
R9098:Gm13088	UTSW	4	143654527	missense	probably benign	0.01
R9185:Gm13088	UTSW	4	143655328	missense	probably benign	0.03
R9422:Gm13088	UTSW	4	143656412	missense	probably damaging	1.00
X0021:Gm13088	UTSW	4	143655748	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGGTTGACATATCCATGCTCC -3'
(R):5'- CCTCACAGATGTCAATTTCCAG -3'

Sequencing Primer
(F):5'- GGTTGACATATCCATGCTCCTTTAAG -3'
(R):5'- CAGGAAAATGAACTCTCTCTGCTGTC -3'

Posted On

2020-07-13