Incidental Mutation 'R8213:Ttll10'
List |< first << previous [record 59 of 65] next >> last >|
ID636249
Institutional Source Beutler Lab
Gene Symbol Ttll10
Ensembl Gene ENSMUSG00000029074
Gene Nametubulin tyrosine ligase-like family, member 10
Synonyms4930595O22Rik, Ttll5, 4833412E22Rik
MMRRC Submission
Accession Numbers

Genbank: NM_029264; MGI: 1921855

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8213 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location156034840-156059414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 156036234 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 433 (M433K)
Ref Sequence ENSEMBL: ENSMUSP00000055671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051509] [ENSMUST00000184348] [ENSMUST00000184684]
Predicted Effect probably benign
Transcript: ENSMUST00000051509
AA Change: M433K

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000055671
Gene: ENSMUSG00000029074
AA Change: M433K

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 63 73 N/A INTRINSIC
low complexity region 104 118 N/A INTRINSIC
Pfam:TTL 189 507 1.8e-48 PFAM
low complexity region 541 583 N/A INTRINSIC
low complexity region 587 600 N/A INTRINSIC
low complexity region 622 638 N/A INTRINSIC
low complexity region 652 671 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184348
AA Change: M462K

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139316
Gene: ENSMUSG00000029074
AA Change: M462K

DomainStartEndE-ValueType
low complexity region 92 102 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Pfam:TTL 218 536 7.9e-48 PFAM
low complexity region 570 612 N/A INTRINSIC
low complexity region 616 629 N/A INTRINSIC
low complexity region 651 667 N/A INTRINSIC
low complexity region 681 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184684
AA Change: M344K

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139077
Gene: ENSMUSG00000029074
AA Change: M344K

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
Pfam:TTL 100 418 2.5e-48 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,756 Y277C probably damaging Het
Acss1 T A 2: 150,619,710 D651V possibly damaging Het
Aktip G T 8: 91,124,866 P243H possibly damaging Het
Arl11 T G 14: 61,311,265 S175A probably benign Het
Aup1 A G 6: 83,054,607 probably benign Het
Avil A T 10: 127,008,321 I250F probably damaging Het
Btnl6 A T 17: 34,508,883 probably null Het
C77080 A T 4: 129,221,459 V1070D possibly damaging Het
Ccdc7b C A 8: 129,178,291 Q137K probably benign Het
Cdk11b G A 4: 155,639,881 E319K unknown Het
Chka A C 19: 3,885,882 E196A probably damaging Het
Depdc5 C T 5: 32,937,637 R753C probably damaging Het
Dhx57 T A 17: 80,275,156 D340V possibly damaging Het
Dicer1 A T 12: 104,702,693 D1243E probably benign Het
Dnajb9 A T 12: 44,207,133 L164M probably benign Het
Dock6 A G 9: 21,831,444 V785A possibly damaging Het
Efcab5 T C 11: 77,116,071 Y909C probably damaging Het
Erp44 A T 4: 48,208,783 S226T probably benign Het
Fgd6 A T 10: 94,044,052 D256V probably benign Het
Fhl5 A T 4: 25,207,113 Y218* probably null Het
Filip1 C A 9: 79,818,092 A1082S probably benign Het
Gm13088 T A 4: 143,654,185 M423L probably benign Het
Gm13128 A T 4: 144,330,460 D71V probably benign Het
Heatr5a G A 12: 51,891,443 T1484M probably damaging Het
Herc1 G T 9: 66,450,888 R2417L probably damaging Het
Hnrnpr A G 4: 136,317,175 probably benign Het
Igsf5 A T 16: 96,372,988 I73F probably damaging Het
Il17ra T C 6: 120,473,034 V91A probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 K548E probably damaging Het
Kdm5d T A Y: 941,515 C1239S probably damaging Het
Mamdc4 G A 2: 25,566,356 T709M probably benign Het
Mybbp1a T A 11: 72,444,721 Y353N probably damaging Het
Nepn A T 10: 52,391,759 E40D probably benign Het
Npat G T 9: 53,570,570 E1193* probably null Het
Nrde2 G A 12: 100,131,003 S846L probably benign Het
Nup205 T C 6: 35,225,203 V1290A probably benign Het
Olfr1009 T A 2: 85,721,501 L32Q probably null Het
Olfr1424 A G 19: 12,059,092 V220A probably benign Het
Olfr517 C A 7: 108,868,519 V212L probably benign Het
Pde6a A T 18: 61,220,696 K31M possibly damaging Het
Pms2 C T 5: 143,914,771 R169C probably damaging Het
Polr2g A T 19: 8,798,257 L30Q probably damaging Het
Prdm15 T A 16: 97,807,060 H679L probably damaging Het
Prl4a1 T G 13: 28,023,386 Y214* probably null Het
Prlr C T 15: 10,329,242 T601M possibly damaging Het
Psen2 A C 1: 180,245,691 S22A probably benign Het
Ralgapa1 C A 12: 55,722,914 R764L probably damaging Het
Scgb2b11 T C 7: 32,209,408 E89G probably damaging Het
Serpina10 T C 12: 103,628,277 I228V probably benign Het
Serpinb1a T A 13: 32,842,999 H320L probably damaging Het
Sesn2 C A 4: 132,498,053 Q267H possibly damaging Het
Sgsm1 A T 5: 113,251,011 W1019R probably damaging Het
Sqle A G 15: 59,321,302 probably null Het
Syt14 T C 1: 192,986,829 M39V probably benign Het
Tgm7 A G 2: 121,101,064 V206A probably damaging Het
Thbs4 T C 13: 92,760,586 probably null Het
Trpv1 T C 11: 73,254,251 F721S probably damaging Het
Vmn1r216 T C 13: 23,099,525 I126T probably benign Het
Vmn2r108 G A 17: 20,470,088 S494F probably benign Het
Vwa3b C T 1: 37,128,939 A603V probably benign Het
Xirp2 T A 2: 67,476,866 N19K probably damaging Het
Zfp397 T A 18: 23,960,722 N421K probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Ttll10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Ttll10 APN 4 156046894 missense probably benign 0.09
IGL02109:Ttll10 APN 4 156047480 missense probably benign
IGL02121:Ttll10 APN 4 156048433 missense probably benign 0.04
F6893:Ttll10 UTSW 4 156048318 missense probably benign 0.00
R0366:Ttll10 UTSW 4 156035155 missense probably damaging 0.97
R0502:Ttll10 UTSW 4 156047548 splice site probably benign
R0503:Ttll10 UTSW 4 156047548 splice site probably benign
R0523:Ttll10 UTSW 4 156045361 nonsense probably null
R0865:Ttll10 UTSW 4 156043678 missense probably damaging 1.00
R0907:Ttll10 UTSW 4 156036164 nonsense probably null
R1125:Ttll10 UTSW 4 156035038 missense possibly damaging 0.73
R1555:Ttll10 UTSW 4 156035139 missense probably benign 0.00
R1797:Ttll10 UTSW 4 156047567 missense probably damaging 0.96
R3899:Ttll10 UTSW 4 156035800 missense probably damaging 1.00
R4426:Ttll10 UTSW 4 156048561 missense possibly damaging 0.55
R5715:Ttll10 UTSW 4 156045391 missense probably damaging 1.00
R5762:Ttll10 UTSW 4 156034981 missense possibly damaging 0.93
R5814:Ttll10 UTSW 4 156047627 missense possibly damaging 0.51
R5958:Ttll10 UTSW 4 156036066 splice site probably null
R5994:Ttll10 UTSW 4 156048732 splice site probably null
R6084:Ttll10 UTSW 4 156045357 missense probably benign 0.34
R7027:Ttll10 UTSW 4 156035801 missense possibly damaging 0.70
R7719:Ttll10 UTSW 4 156047208 splice site probably null
R8010:Ttll10 UTSW 4 156047161 missense probably damaging 1.00
R8118:Ttll10 UTSW 4 156044762 missense probably benign 0.05
R8167:Ttll10 UTSW 4 156044756 missense probably null 0.01
Z1176:Ttll10 UTSW 4 156048517 missense probably benign
Z1177:Ttll10 UTSW 4 156047438 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- CTAGATCTGAGTCCAGCCACTG -3'
(R):5'- AGCCCCATGGTTTTGTTGAG -3'

Sequencing Primer
(F):5'- CACTGGGCACGCTTATGTG -3'
(R):5'- AGTTTCTTACTGTGAGCCTGTGACTC -3'
Posted On2020-07-13