Mutagenetix > Incidental Mutation

Incidental Mutation 'R8213:Depdc5'

636250

Institutional Source

Beutler Lab

Gene Symbol

Depdc5

Ensembl Gene

ENSMUSG00000037426

Gene Name

DEP domain containing 5

Synonyms

MMRRC Submission

067655-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8213 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32863701-32994236 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 32937637 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 753 (R753C)

Ref Sequence

ENSEMBL: ENSMUSP00000113862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000124780]

AlphaFold

P61460

Predicted Effect

probably damaging
Transcript: ENSMUST00000049780
AA Change: R753C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426
AA Change: R753C

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-64	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000087897
AA Change: R762C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: R762C

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	2.3e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	826	836	N/A	INTRINSIC
low complexity region	994	1006	N/A	INTRINSIC
low complexity region	1159	1175	N/A	INTRINSIC
DEP	1184	1259	2.49e-15	SMART
low complexity region	1322	1335	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000119705
AA Change: R753C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: R753C

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3e-117	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1150	1166	N/A	INTRINSIC
DEP	1175	1250	2.49e-15	SMART
low complexity region	1313	1326	N/A	INTRINSIC
low complexity region	1511	1525	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120902
AA Change: R753C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: R753C

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1128	1144	N/A	INTRINSIC
DEP	1153	1228	2.49e-15	SMART
low complexity region	1291	1304	N/A	INTRINSIC
low complexity region	1489	1503	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000124780
AA Change: R115C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000120120
Gene: ENSMUSG00000037426
AA Change: R115C

Domain	Start	End	E-Value	Type
low complexity region	179	189	N/A	INTRINSIC
low complexity region	347	359	N/A	INTRINSIC
SCOP:d1fsha_	519	586	1e-13	SMART
Blast:DEP	537	589	2e-24	BLAST

Predicted Effect

SMART Domains

Protein: ENSMUSP00000121089
Gene: ENSMUSG00000037426
AA Change: R159C

Domain	Start	End	E-Value	Type
low complexity region	54	65	N/A	INTRINSIC
low complexity region	88	97	N/A	INTRINSIC
low complexity region	224	234	N/A	INTRINSIC
low complexity region	392	404	N/A	INTRINSIC
low complexity region	535	551	N/A	INTRINSIC
DEP	560	635	2.49e-15	SMART
low complexity region	698	711	N/A	INTRINSIC
low complexity region	896	910	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.1%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	C	15: 60,919,756	Y277C	probably damaging	Het
Acss1	T	A	2: 150,619,710	D651V	possibly damaging	Het
Aktip	G	T	8: 91,124,866	P243H	possibly damaging	Het
Arl11	T	G	14: 61,311,265	S175A	probably benign	Het
Aup1	A	G	6: 83,054,607		probably benign	Het
Avil	A	T	10: 127,008,321	I250F	probably damaging	Het
Btnl6	A	T	17: 34,508,883		probably null	Het
C77080	A	T	4: 129,221,459	V1070D	possibly damaging	Het
Ccdc7b	C	A	8: 129,178,291	Q137K	probably benign	Het
Cdk11b	G	A	4: 155,639,881	E319K	unknown	Het
Chka	A	C	19: 3,885,882	E196A	probably damaging	Het
Dhx57	T	A	17: 80,275,156	D340V	possibly damaging	Het
Dicer1	A	T	12: 104,702,693	D1243E	probably benign	Het
Dnajb9	A	T	12: 44,207,133	L164M	probably benign	Het
Dock6	A	G	9: 21,831,444	V785A	possibly damaging	Het
Efcab5	T	C	11: 77,116,071	Y909C	probably damaging	Het
Erp44	A	T	4: 48,208,783	S226T	probably benign	Het
Fgd6	A	T	10: 94,044,052	D256V	probably benign	Het
Fhl5	A	T	4: 25,207,113	Y218*	probably null	Het
Filip1	C	A	9: 79,818,092	A1082S	probably benign	Het
Gm13088	T	A	4: 143,654,185	M423L	probably benign	Het
Gm13128	A	T	4: 144,330,460	D71V	probably benign	Het
Heatr5a	G	A	12: 51,891,443	T1484M	probably damaging	Het
Herc1	G	T	9: 66,450,888	R2417L	probably damaging	Het
Hnrnpr	A	G	4: 136,317,175		probably benign	Het
Igsf5	A	T	16: 96,372,988	I73F	probably damaging	Het
Il17ra	T	C	6: 120,473,034	V91A	probably benign	Het
Inpp5f	A	G	7: 128,679,805	D510G	probably damaging	Het
Kbtbd3	A	G	9: 4,331,269	K548E	probably damaging	Het
Kdm5d	T	A	Y: 941,515	C1239S	probably damaging	Het
Mamdc4	G	A	2: 25,566,356	T709M	probably benign	Het
Mybbp1a	T	A	11: 72,444,721	Y353N	probably damaging	Het
Nepn	A	T	10: 52,391,759	E40D	probably benign	Het
Npat	G	T	9: 53,570,570	E1193*	probably null	Het
Nrde2	G	A	12: 100,131,003	S846L	probably benign	Het
Nup205	T	C	6: 35,225,203	V1290A	probably benign	Het
Olfr1009	T	A	2: 85,721,501	L32Q	probably null	Het
Olfr1424	A	G	19: 12,059,092	V220A	probably benign	Het
Olfr517	C	A	7: 108,868,519	V212L	probably benign	Het
Pde6a	A	T	18: 61,220,696	K31M	possibly damaging	Het
Pms2	C	T	5: 143,914,771	R169C	probably damaging	Het
Polr2g	A	T	19: 8,798,257	L30Q	probably damaging	Het
Prdm15	T	A	16: 97,807,060	H679L	probably damaging	Het
Prl4a1	T	G	13: 28,023,386	Y214*	probably null	Het
Prlr	C	T	15: 10,329,242	T601M	possibly damaging	Het
Psen2	A	C	1: 180,245,691	S22A	probably benign	Het
Ralgapa1	C	A	12: 55,722,914	R764L	probably damaging	Het
Scgb2b11	T	C	7: 32,209,408	E89G	probably damaging	Het
Serpina10	T	C	12: 103,628,277	I228V	probably benign	Het
Serpinb1a	T	A	13: 32,842,999	H320L	probably damaging	Het
Sesn2	C	A	4: 132,498,053	Q267H	possibly damaging	Het
Sgsm1	A	T	5: 113,251,011	W1019R	probably damaging	Het
Sqle	A	G	15: 59,321,302		probably null	Het
Syt14	T	C	1: 192,986,829	M39V	probably benign	Het
Tgm7	A	G	2: 121,101,064	V206A	probably damaging	Het
Thbs4	T	C	13: 92,760,586		probably null	Het
Trpv1	T	C	11: 73,254,251	F721S	probably damaging	Het
Ttll10	A	T	4: 156,036,234	M433K	probably benign	Het
Vmn1r216	T	C	13: 23,099,525	I126T	probably benign	Het
Vmn2r108	G	A	17: 20,470,088	S494F	probably benign	Het
Vwa3b	C	T	1: 37,128,939	A603V	probably benign	Het
Xirp2	T	A	2: 67,476,866	N19K	probably damaging	Het
Zfp397	T	A	18: 23,960,722	N421K	probably damaging	Het
Zscan5b	C	T	7: 6,233,947	P232S	possibly damaging	Het

Other mutations in Depdc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Depdc5	APN	5	32967814	splice site	probably null
IGL01019:Depdc5	APN	5	32893401	missense	probably damaging	0.96
IGL01067:Depdc5	APN	5	32899067	splice site	probably null
IGL01405:Depdc5	APN	5	32937689	missense	possibly damaging	0.90
IGL01577:Depdc5	APN	5	32955897	missense	possibly damaging	0.49
IGL01633:Depdc5	APN	5	32924200	missense	probably damaging	1.00
IGL01998:Depdc5	APN	5	32945151	splice site	probably benign
IGL02025:Depdc5	APN	5	32946632	critical splice acceptor site	probably null
IGL02167:Depdc5	APN	5	32903801	missense	probably damaging	1.00
IGL02537:Depdc5	APN	5	32967787	missense	probably damaging	1.00
IGL02812:Depdc5	APN	5	32893368	splice site	probably benign
IGL03001:Depdc5	APN	5	32945090	missense	possibly damaging	0.74
IGL03253:Depdc5	APN	5	32868813	unclassified	probably benign
alligator	UTSW	5	32964507	splice site	probably null
lagarto	UTSW	5	32979508	missense	probably damaging	1.00
sauros	UTSW	5	32986966	missense	possibly damaging	0.92
IGL02988:Depdc5	UTSW	5	32956167	splice site	probably null
R0038:Depdc5	UTSW	5	32868853	missense	probably benign	0.01
R0038:Depdc5	UTSW	5	32868853	missense	probably benign	0.01
R0153:Depdc5	UTSW	5	32933937	splice site	probably benign
R0179:Depdc5	UTSW	5	32901574	unclassified	probably benign
R0212:Depdc5	UTSW	5	32912242	missense	probably benign	0.00
R0239:Depdc5	UTSW	5	32943240	missense	probably damaging	1.00
R0239:Depdc5	UTSW	5	32943240	missense	probably damaging	1.00
R0302:Depdc5	UTSW	5	32904546	critical splice donor site	probably benign
R0511:Depdc5	UTSW	5	32945028	nonsense	probably null
R0677:Depdc5	UTSW	5	32901470	missense	probably damaging	1.00
R0884:Depdc5	UTSW	5	32917978	missense	possibly damaging	0.94
R0973:Depdc5	UTSW	5	32986966	missense	possibly damaging	0.92
R1314:Depdc5	UTSW	5	32877074	missense	probably damaging	1.00
R1611:Depdc5	UTSW	5	32990953	missense	probably damaging	1.00
R1687:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R1748:Depdc5	UTSW	5	32917942	missense	probably benign	0.24
R1903:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R1956:Depdc5	UTSW	5	32903831	missense	probably damaging	1.00
R1997:Depdc5	UTSW	5	32901906	critical splice donor site	probably null
R2079:Depdc5	UTSW	5	32946674	missense	possibly damaging	0.75
R2131:Depdc5	UTSW	5	32990781	nonsense	probably null
R2291:Depdc5	UTSW	5	32979402	missense	probably damaging	1.00
R2422:Depdc5	UTSW	5	32991035	missense	probably damaging	1.00
R2851:Depdc5	UTSW	5	32924171	missense	probably damaging	0.96
R2852:Depdc5	UTSW	5	32924171	missense	probably damaging	0.96
R2937:Depdc5	UTSW	5	32901621	splice site	probably null
R2938:Depdc5	UTSW	5	32901621	splice site	probably null
R2974:Depdc5	UTSW	5	32934017	critical splice donor site	probably null
R3884:Depdc5	UTSW	5	32944077	missense	probably damaging	1.00
R3967:Depdc5	UTSW	5	32944115	nonsense	probably null
R4118:Depdc5	UTSW	5	32964635	missense	probably damaging	1.00
R4197:Depdc5	UTSW	5	32991203	missense	possibly damaging	0.93
R4407:Depdc5	UTSW	5	32904534	critical splice donor site	probably null
R4534:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R4535:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R4538:Depdc5	UTSW	5	32983946	missense	probably damaging	1.00
R4613:Depdc5	UTSW	5	32975446	missense	probably damaging	1.00
R4736:Depdc5	UTSW	5	32975322	missense	probably benign
R4738:Depdc5	UTSW	5	32975322	missense	probably benign
R4765:Depdc5	UTSW	5	32937635	missense	probably damaging	1.00
R5021:Depdc5	UTSW	5	32979414	missense	probably damaging	1.00
R5259:Depdc5	UTSW	5	32938291	missense	probably damaging	1.00
R5261:Depdc5	UTSW	5	32938291	missense	probably damaging	1.00
R5541:Depdc5	UTSW	5	32864629	utr 5 prime	probably benign
R5594:Depdc5	UTSW	5	32901490	missense	possibly damaging	0.46
R5929:Depdc5	UTSW	5	32975506	nonsense	probably null
R6132:Depdc5	UTSW	5	32910467	missense	probably damaging	0.99
R6146:Depdc5	UTSW	5	32968731	missense	probably benign	0.01
R6336:Depdc5	UTSW	5	32964507	splice site	probably null
R6468:Depdc5	UTSW	5	32912231	missense	probably benign	0.02
R6911:Depdc5	UTSW	5	32924192	missense	probably damaging	1.00
R6969:Depdc5	UTSW	5	32983860	missense	probably damaging	1.00
R7002:Depdc5	UTSW	5	32877158	splice site	probably null
R7066:Depdc5	UTSW	5	32901848	missense	probably benign	0.08
R7231:Depdc5	UTSW	5	32901865	missense	possibly damaging	0.92
R7264:Depdc5	UTSW	5	32967745	missense	probably benign
R7302:Depdc5	UTSW	5	32979508	missense	probably damaging	1.00
R7386:Depdc5	UTSW	5	32927936	missense	probably benign
R7564:Depdc5	UTSW	5	32901510	missense	probably damaging	1.00
R7636:Depdc5	UTSW	5	32917983	missense	probably benign
R7795:Depdc5	UTSW	5	32944103	missense	probably damaging	1.00
R7845:Depdc5	UTSW	5	32903915	splice site	probably null
R8013:Depdc5	UTSW	5	32973842	missense	probably benign	0.01
R8037:Depdc5	UTSW	5	32959348	critical splice donor site	probably null
R8038:Depdc5	UTSW	5	32959348	critical splice donor site	probably null
R8065:Depdc5	UTSW	5	32895908	missense	possibly damaging	0.89
R8067:Depdc5	UTSW	5	32895908	missense	possibly damaging	0.89
R8108:Depdc5	UTSW	5	32945049	missense	probably benign	0.01
R8112:Depdc5	UTSW	5	32968706	missense	possibly damaging	0.67
R8382:Depdc5	UTSW	5	32927898	missense	probably benign	0.00
R8680:Depdc5	UTSW	5	32944038	missense	possibly damaging	0.48
R8743:Depdc5	UTSW	5	32924243	missense	probably benign	0.10
R8754:Depdc5	UTSW	5	32979537	missense	probably benign	0.00
R9157:Depdc5	UTSW	5	32945108	missense	probably damaging	0.98
R9364:Depdc5	UTSW	5	32964732	missense	probably benign
R9441:Depdc5	UTSW	5	32937698	missense	probably benign	0.03
R9450:Depdc5	UTSW	5	32934010	missense	probably benign
R9459:Depdc5	UTSW	5	32990773	missense	probably damaging	0.99
R9554:Depdc5	UTSW	5	32964732	missense	probably benign
R9569:Depdc5	UTSW	5	32867977	missense	probably damaging	0.98
R9647:Depdc5	UTSW	5	32924223	missense	possibly damaging	0.94
R9688:Depdc5	UTSW	5	32897932	nonsense	probably null
X0027:Depdc5	UTSW	5	32904292	missense	probably damaging	1.00
Z1176:Depdc5	UTSW	5	32943282	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- GCAATTTCGATCACCTTTTACCATG -3'
(R):5'- GGACACGAAAGGCTTCAAAC -3'

Sequencing Primer
(F):5'- GATCACCTTTTACCATGAACTTCAC -3'
(R):5'- GAAAGGCTTCAAACCTCAGTGTTC -3'

Posted On

2020-07-13