Incidental Mutation 'R8213:Sgsm1'
ID636251
Institutional Source Beutler Lab
Gene Symbol Sgsm1
Ensembl Gene ENSMUSG00000042216
Gene Namesmall G protein signaling modulator 1
SynonymsRutbc2, 2410098H20Rik, D5Bwg1524e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8213 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location113243220-113310786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113251011 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 1019 (W1019R)
Ref Sequence ENSEMBL: ENSMUSP00000046544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000057209]
Predicted Effect probably damaging
Transcript: ENSMUST00000048112
AA Change: W1019R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216
AA Change: W1019R

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
TBC 559 1053 2.88e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000057209
AA Change: W732R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084106
Gene: ENSMUSG00000042216
AA Change: W732R

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
TBC 272 766 2.88e-29 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,756 Y277C probably damaging Het
Acss1 T A 2: 150,619,710 D651V possibly damaging Het
Aktip G T 8: 91,124,866 P243H possibly damaging Het
Arl11 T G 14: 61,311,265 S175A probably benign Het
Aup1 A G 6: 83,054,607 probably benign Het
Avil A T 10: 127,008,321 I250F probably damaging Het
Btnl6 A T 17: 34,508,883 probably null Het
C77080 A T 4: 129,221,459 V1070D possibly damaging Het
Ccdc7b C A 8: 129,178,291 Q137K probably benign Het
Cdk11b G A 4: 155,639,881 E319K unknown Het
Chka A C 19: 3,885,882 E196A probably damaging Het
Depdc5 C T 5: 32,937,637 R753C probably damaging Het
Dhx57 T A 17: 80,275,156 D340V possibly damaging Het
Dicer1 A T 12: 104,702,693 D1243E probably benign Het
Dnajb9 A T 12: 44,207,133 L164M probably benign Het
Dock6 A G 9: 21,831,444 V785A possibly damaging Het
Efcab5 T C 11: 77,116,071 Y909C probably damaging Het
Erp44 A T 4: 48,208,783 S226T probably benign Het
Fgd6 A T 10: 94,044,052 D256V probably benign Het
Fhl5 A T 4: 25,207,113 Y218* probably null Het
Filip1 C A 9: 79,818,092 A1082S probably benign Het
Gm13088 T A 4: 143,654,185 M423L probably benign Het
Gm13128 A T 4: 144,330,460 D71V probably benign Het
Heatr5a G A 12: 51,891,443 T1484M probably damaging Het
Herc1 G T 9: 66,450,888 R2417L probably damaging Het
Hnrnpr A G 4: 136,317,175 probably benign Het
Igsf5 A T 16: 96,372,988 I73F probably damaging Het
Il17ra T C 6: 120,473,034 V91A probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 K548E probably damaging Het
Kdm5d T A Y: 941,515 C1239S probably damaging Het
Mamdc4 G A 2: 25,566,356 T709M probably benign Het
Mybbp1a T A 11: 72,444,721 Y353N probably damaging Het
Nepn A T 10: 52,391,759 E40D probably benign Het
Npat G T 9: 53,570,570 E1193* probably null Het
Nrde2 G A 12: 100,131,003 S846L probably benign Het
Nup205 T C 6: 35,225,203 V1290A probably benign Het
Olfr1009 T A 2: 85,721,501 L32Q probably null Het
Olfr1424 A G 19: 12,059,092 V220A probably benign Het
Olfr517 C A 7: 108,868,519 V212L probably benign Het
Pde6a A T 18: 61,220,696 K31M possibly damaging Het
Pms2 C T 5: 143,914,771 R169C probably damaging Het
Polr2g A T 19: 8,798,257 L30Q probably damaging Het
Prdm15 T A 16: 97,807,060 H679L probably damaging Het
Prl4a1 T G 13: 28,023,386 Y214* probably null Het
Prlr C T 15: 10,329,242 T601M possibly damaging Het
Psen2 A C 1: 180,245,691 S22A probably benign Het
Ralgapa1 C A 12: 55,722,914 R764L probably damaging Het
Scgb2b11 T C 7: 32,209,408 E89G probably damaging Het
Serpina10 T C 12: 103,628,277 I228V probably benign Het
Serpinb1a T A 13: 32,842,999 H320L probably damaging Het
Sesn2 C A 4: 132,498,053 Q267H possibly damaging Het
Sqle A G 15: 59,321,302 probably null Het
Syt14 T C 1: 192,986,829 M39V probably benign Het
Tgm7 A G 2: 121,101,064 V206A probably damaging Het
Thbs4 T C 13: 92,760,586 probably null Het
Trpv1 T C 11: 73,254,251 F721S probably damaging Het
Ttll10 A T 4: 156,036,234 M433K probably benign Het
Vmn1r216 T C 13: 23,099,525 I126T probably benign Het
Vmn2r108 G A 17: 20,470,088 S494F probably benign Het
Vwa3b C T 1: 37,128,939 A603V probably benign Het
Xirp2 T A 2: 67,476,866 N19K probably damaging Het
Zfp397 T A 18: 23,960,722 N421K probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Sgsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgsm1 APN 5 113245064 missense probably benign 0.00
IGL00503:Sgsm1 APN 5 113276142 missense probably benign 0.00
IGL01377:Sgsm1 APN 5 113276182 splice site probably benign
IGL01602:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01605:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01669:Sgsm1 APN 5 113263490 missense probably benign
IGL01920:Sgsm1 APN 5 113273605 missense probably damaging 1.00
IGL01951:Sgsm1 APN 5 113286767 splice site probably benign
IGL02387:Sgsm1 APN 5 113253063 missense possibly damaging 0.93
IGL02690:Sgsm1 APN 5 113286767 splice site probably benign
IGL03177:Sgsm1 APN 5 113250993 missense probably damaging 1.00
IGL03186:Sgsm1 APN 5 113285021 missense probably benign 0.00
IGL03398:Sgsm1 APN 5 113255316 missense possibly damaging 0.67
caliente UTSW 5 113280462 intron probably benign
Chili UTSW 5 113258123 intron probably benign
pimiento UTSW 5 113263257 missense probably benign 0.15
R0048:Sgsm1 UTSW 5 113268750 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0082:Sgsm1 UTSW 5 113288836 missense probably benign 0.01
R0085:Sgsm1 UTSW 5 113279270 splice site probably benign
R0099:Sgsm1 UTSW 5 113274360 splice site probably benign
R0269:Sgsm1 UTSW 5 113286929 critical splice acceptor site probably null
R0310:Sgsm1 UTSW 5 113263705 missense probably benign 0.00
R0325:Sgsm1 UTSW 5 113288835 missense probably damaging 0.99
R0420:Sgsm1 UTSW 5 113263759 missense probably benign 0.16
R0594:Sgsm1 UTSW 5 113310562 missense probably benign 0.00
R0599:Sgsm1 UTSW 5 113245028 missense probably damaging 1.00
R0631:Sgsm1 UTSW 5 113285123 splice site probably benign
R0744:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0833:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0919:Sgsm1 UTSW 5 113258842 missense probably damaging 1.00
R0944:Sgsm1 UTSW 5 113265874 missense probably benign 0.40
R1169:Sgsm1 UTSW 5 113279485 missense probably damaging 1.00
R1232:Sgsm1 UTSW 5 113273711 nonsense probably null
R1473:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R1535:Sgsm1 UTSW 5 113263269 missense possibly damaging 0.93
R1796:Sgsm1 UTSW 5 113273617 missense possibly damaging 0.58
R1878:Sgsm1 UTSW 5 113263515 missense probably damaging 0.97
R2084:Sgsm1 UTSW 5 113285400 missense probably damaging 1.00
R3855:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R3856:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R4294:Sgsm1 UTSW 5 113285404 missense probably damaging 1.00
R4373:Sgsm1 UTSW 5 113258123 intron probably benign
R4558:Sgsm1 UTSW 5 113258111 intron probably benign
R4610:Sgsm1 UTSW 5 113255307 missense probably damaging 1.00
R4667:Sgsm1 UTSW 5 113260047 critical splice donor site probably null
R4838:Sgsm1 UTSW 5 113282626 missense probably damaging 1.00
R4890:Sgsm1 UTSW 5 113280462 intron probably benign
R4992:Sgsm1 UTSW 5 113282620 missense possibly damaging 0.89
R5366:Sgsm1 UTSW 5 113251039 missense possibly damaging 0.91
R5776:Sgsm1 UTSW 5 113250957 missense probably damaging 1.00
R5813:Sgsm1 UTSW 5 113250956 missense probably damaging 1.00
R6000:Sgsm1 UTSW 5 113286838 missense probably damaging 1.00
R6354:Sgsm1 UTSW 5 113282656 missense probably damaging 0.99
R6440:Sgsm1 UTSW 5 113279131 critical splice donor site probably null
R6831:Sgsm1 UTSW 5 113280380 missense probably damaging 0.97
R7307:Sgsm1 UTSW 5 113273646 missense probably benign 0.00
R7309:Sgsm1 UTSW 5 113268846 splice site probably null
R7387:Sgsm1 UTSW 5 113263700 missense probably damaging 1.00
R7439:Sgsm1 UTSW 5 113274321 missense probably damaging 0.99
R7485:Sgsm1 UTSW 5 113279635 splice site probably null
R7624:Sgsm1 UTSW 5 113274335 nonsense probably null
R7632:Sgsm1 UTSW 5 113276082 missense possibly damaging 0.54
R7669:Sgsm1 UTSW 5 113253024 missense probably damaging 1.00
R7727:Sgsm1 UTSW 5 113274327 missense possibly damaging 0.95
R7732:Sgsm1 UTSW 5 113266330 missense probably benign 0.26
R7961:Sgsm1 UTSW 5 113282644 missense probably damaging 1.00
R8088:Sgsm1 UTSW 5 113255268 missense probably damaging 1.00
R8278:Sgsm1 UTSW 5 113260092 missense probably damaging 0.98
Z1177:Sgsm1 UTSW 5 113282710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTACCAAGCTCTAGCATTGG -3'
(R):5'- TTCTGCCTCTGATGACCCAG -3'

Sequencing Primer
(F):5'- AAGCTCTAGCATTGGGAGCC -3'
(R):5'- TGATGACCCAGGCCACAGATG -3'
Posted On2020-07-13