Incidental Mutation 'R8213:Sgsm1'
ID 636251
Institutional Source Beutler Lab
Gene Symbol Sgsm1
Ensembl Gene ENSMUSG00000042216
Gene Name small G protein signaling modulator 1
Synonyms Rutbc2, D5Bwg1524e, 2410098H20Rik
MMRRC Submission 067655-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8213 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 113391086-113458652 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 113398877 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 1019 (W1019R)
Ref Sequence ENSEMBL: ENSMUSP00000046544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000057209]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000048112
AA Change: W1019R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216
AA Change: W1019R

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
TBC 559 1053 2.88e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000057209
AA Change: W732R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084106
Gene: ENSMUSG00000042216
AA Change: W732R

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
TBC 272 766 2.88e-29 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,791,605 (GRCm39) Y277C probably damaging Het
Acss1 T A 2: 150,461,630 (GRCm39) D651V possibly damaging Het
Aktip G T 8: 91,851,494 (GRCm39) P243H possibly damaging Het
Arl11 T G 14: 61,548,714 (GRCm39) S175A probably benign Het
Aup1 A G 6: 83,031,588 (GRCm39) probably benign Het
Avil A T 10: 126,844,190 (GRCm39) I250F probably damaging Het
Btnl6 A T 17: 34,727,857 (GRCm39) probably null Het
Ccdc7b C A 8: 129,904,772 (GRCm39) Q137K probably benign Het
Cdk11b G A 4: 155,724,338 (GRCm39) E319K unknown Het
Chka A C 19: 3,935,882 (GRCm39) E196A probably damaging Het
Depdc5 C T 5: 33,094,981 (GRCm39) R753C probably damaging Het
Dhx57 T A 17: 80,582,585 (GRCm39) D340V possibly damaging Het
Dicer1 A T 12: 104,668,952 (GRCm39) D1243E probably benign Het
Dnajb9 A T 12: 44,253,916 (GRCm39) L164M probably benign Het
Dock6 A G 9: 21,742,740 (GRCm39) V785A possibly damaging Het
Efcab5 T C 11: 77,006,897 (GRCm39) Y909C probably damaging Het
Erp44 A T 4: 48,208,783 (GRCm39) S226T probably benign Het
Fgd6 A T 10: 93,879,914 (GRCm39) D256V probably benign Het
Fhl5 A T 4: 25,207,113 (GRCm39) Y218* probably null Het
Filip1 C A 9: 79,725,374 (GRCm39) A1082S probably benign Het
Heatr5a G A 12: 51,938,226 (GRCm39) T1484M probably damaging Het
Herc1 G T 9: 66,358,170 (GRCm39) R2417L probably damaging Het
Hnrnpr A G 4: 136,044,486 (GRCm39) probably benign Het
Igsf5 A T 16: 96,174,188 (GRCm39) I73F probably damaging Het
Il17ra T C 6: 120,449,995 (GRCm39) V91A probably benign Het
Inpp5f A G 7: 128,281,529 (GRCm39) D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 (GRCm39) K548E probably damaging Het
Kdm5d T A Y: 941,515 (GRCm39) C1239S probably damaging Het
Mamdc4 G A 2: 25,456,368 (GRCm39) T709M probably benign Het
Mybbp1a T A 11: 72,335,547 (GRCm39) Y353N probably damaging Het
Nepn A T 10: 52,267,855 (GRCm39) E40D probably benign Het
Nhsl3 A T 4: 129,115,252 (GRCm39) V1070D possibly damaging Het
Npat G T 9: 53,481,870 (GRCm39) E1193* probably null Het
Nrde2 G A 12: 100,097,262 (GRCm39) S846L probably benign Het
Nup205 T C 6: 35,202,138 (GRCm39) V1290A probably benign Het
Or10a49 C A 7: 108,467,726 (GRCm39) V212L probably benign Het
Or4d10b A G 19: 12,036,456 (GRCm39) V220A probably benign Het
Or5g9 T A 2: 85,551,845 (GRCm39) L32Q probably null Het
Pde6a A T 18: 61,353,768 (GRCm39) K31M possibly damaging Het
Pms2 C T 5: 143,851,589 (GRCm39) R169C probably damaging Het
Polr2g A T 19: 8,775,621 (GRCm39) L30Q probably damaging Het
Pramel22 T A 4: 143,380,755 (GRCm39) M423L probably benign Het
Pramel30 A T 4: 144,057,030 (GRCm39) D71V probably benign Het
Prdm15 T A 16: 97,608,260 (GRCm39) H679L probably damaging Het
Prl4a1 T G 13: 28,207,369 (GRCm39) Y214* probably null Het
Prlr C T 15: 10,329,328 (GRCm39) T601M possibly damaging Het
Psen2 A C 1: 180,073,256 (GRCm39) S22A probably benign Het
Ralgapa1 C A 12: 55,769,699 (GRCm39) R764L probably damaging Het
Scgb2b11 T C 7: 31,908,833 (GRCm39) E89G probably damaging Het
Serpina10 T C 12: 103,594,536 (GRCm39) I228V probably benign Het
Serpinb1a T A 13: 33,026,982 (GRCm39) H320L probably damaging Het
Sesn2 C A 4: 132,225,364 (GRCm39) Q267H possibly damaging Het
Sqle A G 15: 59,193,151 (GRCm39) probably null Het
Syt14 T C 1: 192,669,137 (GRCm39) M39V probably benign Het
Tgm7 A G 2: 120,931,545 (GRCm39) V206A probably damaging Het
Thbs4 T C 13: 92,897,094 (GRCm39) probably null Het
Trpv1 T C 11: 73,145,077 (GRCm39) F721S probably damaging Het
Ttll10 A T 4: 156,120,691 (GRCm39) M433K probably benign Het
Vmn1r216 T C 13: 23,283,695 (GRCm39) I126T probably benign Het
Vmn2r108 G A 17: 20,690,350 (GRCm39) S494F probably benign Het
Vwa3b C T 1: 37,168,020 (GRCm39) A603V probably benign Het
Xirp2 T A 2: 67,307,210 (GRCm39) N19K probably damaging Het
Zfp397 T A 18: 24,093,779 (GRCm39) N421K probably damaging Het
Zscan5b C T 7: 6,236,946 (GRCm39) P232S possibly damaging Het
Other mutations in Sgsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgsm1 APN 5 113,392,930 (GRCm39) missense probably benign 0.00
IGL00503:Sgsm1 APN 5 113,424,008 (GRCm39) missense probably benign 0.00
IGL01377:Sgsm1 APN 5 113,424,048 (GRCm39) splice site probably benign
IGL01602:Sgsm1 APN 5 113,433,531 (GRCm39) missense possibly damaging 0.92
IGL01605:Sgsm1 APN 5 113,433,531 (GRCm39) missense possibly damaging 0.92
IGL01669:Sgsm1 APN 5 113,411,356 (GRCm39) missense probably benign
IGL01920:Sgsm1 APN 5 113,421,471 (GRCm39) missense probably damaging 1.00
IGL01951:Sgsm1 APN 5 113,434,633 (GRCm39) splice site probably benign
IGL02387:Sgsm1 APN 5 113,400,929 (GRCm39) missense possibly damaging 0.93
IGL02690:Sgsm1 APN 5 113,434,633 (GRCm39) splice site probably benign
IGL03177:Sgsm1 APN 5 113,398,859 (GRCm39) missense probably damaging 1.00
IGL03186:Sgsm1 APN 5 113,432,887 (GRCm39) missense probably benign 0.00
IGL03398:Sgsm1 APN 5 113,403,182 (GRCm39) missense possibly damaging 0.67
caliente UTSW 5 113,428,328 (GRCm39) intron probably benign
Chili UTSW 5 113,405,989 (GRCm39) intron probably benign
pimiento UTSW 5 113,411,123 (GRCm39) missense probably benign 0.15
R0048:Sgsm1 UTSW 5 113,416,616 (GRCm39) missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113,432,953 (GRCm39) missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113,432,953 (GRCm39) missense probably damaging 1.00
R0082:Sgsm1 UTSW 5 113,436,702 (GRCm39) missense probably benign 0.01
R0085:Sgsm1 UTSW 5 113,427,136 (GRCm39) splice site probably benign
R0099:Sgsm1 UTSW 5 113,422,226 (GRCm39) splice site probably benign
R0269:Sgsm1 UTSW 5 113,434,795 (GRCm39) critical splice acceptor site probably null
R0310:Sgsm1 UTSW 5 113,411,571 (GRCm39) missense probably benign 0.00
R0325:Sgsm1 UTSW 5 113,436,701 (GRCm39) missense probably damaging 0.99
R0420:Sgsm1 UTSW 5 113,411,625 (GRCm39) missense probably benign 0.16
R0594:Sgsm1 UTSW 5 113,458,428 (GRCm39) missense probably benign 0.00
R0599:Sgsm1 UTSW 5 113,392,894 (GRCm39) missense probably damaging 1.00
R0631:Sgsm1 UTSW 5 113,432,989 (GRCm39) splice site probably benign
R0744:Sgsm1 UTSW 5 113,427,050 (GRCm39) missense probably benign 0.38
R0833:Sgsm1 UTSW 5 113,427,050 (GRCm39) missense probably benign 0.38
R0919:Sgsm1 UTSW 5 113,406,708 (GRCm39) missense probably damaging 1.00
R0944:Sgsm1 UTSW 5 113,413,740 (GRCm39) missense probably benign 0.40
R1169:Sgsm1 UTSW 5 113,427,351 (GRCm39) missense probably damaging 1.00
R1232:Sgsm1 UTSW 5 113,421,577 (GRCm39) nonsense probably null
R1473:Sgsm1 UTSW 5 113,411,123 (GRCm39) missense probably benign 0.15
R1535:Sgsm1 UTSW 5 113,411,135 (GRCm39) missense possibly damaging 0.93
R1796:Sgsm1 UTSW 5 113,421,483 (GRCm39) missense possibly damaging 0.58
R1878:Sgsm1 UTSW 5 113,411,381 (GRCm39) missense probably damaging 0.97
R2084:Sgsm1 UTSW 5 113,433,266 (GRCm39) missense probably damaging 1.00
R3855:Sgsm1 UTSW 5 113,411,125 (GRCm39) missense probably benign 0.01
R3856:Sgsm1 UTSW 5 113,411,125 (GRCm39) missense probably benign 0.01
R4294:Sgsm1 UTSW 5 113,433,270 (GRCm39) missense probably damaging 1.00
R4373:Sgsm1 UTSW 5 113,405,989 (GRCm39) intron probably benign
R4558:Sgsm1 UTSW 5 113,405,977 (GRCm39) intron probably benign
R4610:Sgsm1 UTSW 5 113,403,173 (GRCm39) missense probably damaging 1.00
R4667:Sgsm1 UTSW 5 113,407,913 (GRCm39) critical splice donor site probably null
R4838:Sgsm1 UTSW 5 113,430,492 (GRCm39) missense probably damaging 1.00
R4890:Sgsm1 UTSW 5 113,428,328 (GRCm39) intron probably benign
R4992:Sgsm1 UTSW 5 113,430,486 (GRCm39) missense possibly damaging 0.89
R5366:Sgsm1 UTSW 5 113,398,905 (GRCm39) missense possibly damaging 0.91
R5776:Sgsm1 UTSW 5 113,398,823 (GRCm39) missense probably damaging 1.00
R5813:Sgsm1 UTSW 5 113,398,822 (GRCm39) missense probably damaging 1.00
R6000:Sgsm1 UTSW 5 113,434,704 (GRCm39) missense probably damaging 1.00
R6354:Sgsm1 UTSW 5 113,430,522 (GRCm39) missense probably damaging 0.99
R6440:Sgsm1 UTSW 5 113,426,997 (GRCm39) critical splice donor site probably null
R6831:Sgsm1 UTSW 5 113,428,246 (GRCm39) missense probably damaging 0.97
R7307:Sgsm1 UTSW 5 113,421,512 (GRCm39) missense probably benign 0.00
R7309:Sgsm1 UTSW 5 113,416,712 (GRCm39) splice site probably null
R7387:Sgsm1 UTSW 5 113,411,566 (GRCm39) missense probably damaging 1.00
R7439:Sgsm1 UTSW 5 113,422,187 (GRCm39) missense probably damaging 0.99
R7485:Sgsm1 UTSW 5 113,427,501 (GRCm39) splice site probably null
R7624:Sgsm1 UTSW 5 113,422,201 (GRCm39) nonsense probably null
R7632:Sgsm1 UTSW 5 113,423,948 (GRCm39) missense possibly damaging 0.54
R7669:Sgsm1 UTSW 5 113,400,890 (GRCm39) missense probably damaging 1.00
R7727:Sgsm1 UTSW 5 113,422,193 (GRCm39) missense possibly damaging 0.95
R7732:Sgsm1 UTSW 5 113,414,196 (GRCm39) missense probably benign 0.26
R7961:Sgsm1 UTSW 5 113,430,510 (GRCm39) missense probably damaging 1.00
R8088:Sgsm1 UTSW 5 113,403,134 (GRCm39) missense probably damaging 1.00
R8278:Sgsm1 UTSW 5 113,407,958 (GRCm39) missense probably damaging 0.98
R8480:Sgsm1 UTSW 5 113,411,284 (GRCm39) missense probably benign 0.01
R8796:Sgsm1 UTSW 5 113,411,123 (GRCm39) missense probably benign 0.15
R8816:Sgsm1 UTSW 5 113,435,097 (GRCm39) missense probably damaging 1.00
R8904:Sgsm1 UTSW 5 113,421,495 (GRCm39) missense probably benign 0.00
R8905:Sgsm1 UTSW 5 113,421,495 (GRCm39) missense probably benign 0.00
R8952:Sgsm1 UTSW 5 113,432,861 (GRCm39) missense probably damaging 1.00
R9046:Sgsm1 UTSW 5 113,436,725 (GRCm39) missense probably damaging 1.00
R9162:Sgsm1 UTSW 5 113,430,577 (GRCm39) missense probably damaging 1.00
R9249:Sgsm1 UTSW 5 113,428,201 (GRCm39) missense possibly damaging 0.86
R9375:Sgsm1 UTSW 5 113,422,139 (GRCm39) missense unknown
R9377:Sgsm1 UTSW 5 113,436,741 (GRCm39) missense probably damaging 1.00
R9461:Sgsm1 UTSW 5 113,423,898 (GRCm39) critical splice donor site probably null
R9662:Sgsm1 UTSW 5 113,427,097 (GRCm39) missense probably benign 0.03
R9722:Sgsm1 UTSW 5 113,428,207 (GRCm39) missense possibly damaging 0.75
R9726:Sgsm1 UTSW 5 113,458,418 (GRCm39) missense probably benign
Z1177:Sgsm1 UTSW 5 113,430,576 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTACCAAGCTCTAGCATTGG -3'
(R):5'- TTCTGCCTCTGATGACCCAG -3'

Sequencing Primer
(F):5'- AAGCTCTAGCATTGGGAGCC -3'
(R):5'- TGATGACCCAGGCCACAGATG -3'
Posted On 2020-07-13