Incidental Mutation 'R8213:Pms2'
List |< first << previous [record 42 of 65] next >> last >|
ID636252
Institutional Source Beutler Lab
Gene Symbol Pms2
Ensembl Gene ENSMUSG00000079109
Gene NamePMS1 homolog2, mismatch repair system component
Synonymsmismatch repair, DNA mismatch repair
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R8213 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location143909964-143933968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 143914771 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 169 (R169C)
Ref Sequence ENSEMBL: ENSMUSP00000119875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031613] [ENSMUST00000100483] [ENSMUST00000110709] [ENSMUST00000148011] [ENSMUST00000164999]
Predicted Effect probably benign
Transcript: ENSMUST00000031613
SMART Domains Protein: ENSMUSP00000031613
Gene: ENSMUSG00000029610

DomainStartEndE-ValueType
Pfam:AIMP2_LysRS_bd 1 44 8.3e-26 PFAM
low complexity region 133 142 N/A INTRINSIC
Pfam:GST_C_3 231 308 2.5e-10 PFAM
Pfam:GST_C 242 310 5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100483
SMART Domains Protein: ENSMUSP00000098052
Gene: ENSMUSG00000029610

DomainStartEndE-ValueType
low complexity region 93 102 N/A INTRINSIC
Pfam:GST_C_3 185 268 1.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110709
AA Change: R169C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106337
Gene: ENSMUSG00000079109
AA Change: R169C

DomainStartEndE-ValueType
HATPase_c 30 165 3.77e-1 SMART
MutL_C 277 421 1.59e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148011
AA Change: R169C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119875
Gene: ENSMUSG00000079109
AA Change: R169C

DomainStartEndE-ValueType
HATPase_c 30 165 3.77e-1 SMART
DNA_mis_repair 227 364 4.76e-41 SMART
MutL_C 675 819 1.59e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164999
SMART Domains Protein: ENSMUSP00000133062
Gene: ENSMUSG00000079109

DomainStartEndE-ValueType
DNA_mis_repair 1 70 4.47e-2 SMART
Meta Mutation Damage Score 0.9450 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a key component of the mismatch repair system that functions to correct DNA mismatches and small insertions and deletions that can occur during DNA replication and homologous recombination. This protein forms heterodimers with the gene product of the mutL homolog 1 (MLH1) gene to form the MutL-alpha heterodimer. The MutL-alpha heterodimer possesses an endonucleolytic activity that is activated following recognition of mismatches and insertion/deletion loops by the MutS-alpha and MutS-beta heterodimers, and is necessary for removal of the mismatched DNA. There is a DQHA(X)2E(X)4E motif found at the C-terminus of the protein encoded by this gene that forms part of the active site of the nuclease. Mutations in this gene have been associated with hereditary nonpolyposis colorectal cancer (HNPCC; also known as Lynch syndrome) and Turcot syndrome. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit microsatellite instability and develop a high incidence of lymphomas with some sarcomas after 6 months of age. Mutant males are sterile, with impaired synapsis and only abnormal spermatozoa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,756 Y277C probably damaging Het
Acss1 T A 2: 150,619,710 D651V possibly damaging Het
Aktip G T 8: 91,124,866 P243H possibly damaging Het
Arl11 T G 14: 61,311,265 S175A probably benign Het
Aup1 A G 6: 83,054,607 probably benign Het
Avil A T 10: 127,008,321 I250F probably damaging Het
Btnl6 A T 17: 34,508,883 probably null Het
C77080 A T 4: 129,221,459 V1070D possibly damaging Het
Ccdc7b C A 8: 129,178,291 Q137K probably benign Het
Cdk11b G A 4: 155,639,881 E319K unknown Het
Chka A C 19: 3,885,882 E196A probably damaging Het
Depdc5 C T 5: 32,937,637 R753C probably damaging Het
Dhx57 T A 17: 80,275,156 D340V possibly damaging Het
Dicer1 A T 12: 104,702,693 D1243E probably benign Het
Dnajb9 A T 12: 44,207,133 L164M probably benign Het
Dock6 A G 9: 21,831,444 V785A possibly damaging Het
Efcab5 T C 11: 77,116,071 Y909C probably damaging Het
Erp44 A T 4: 48,208,783 S226T probably benign Het
Fgd6 A T 10: 94,044,052 D256V probably benign Het
Fhl5 A T 4: 25,207,113 Y218* probably null Het
Filip1 C A 9: 79,818,092 A1082S probably benign Het
Gm13088 T A 4: 143,654,185 M423L probably benign Het
Gm13128 A T 4: 144,330,460 D71V probably benign Het
Heatr5a G A 12: 51,891,443 T1484M probably damaging Het
Herc1 G T 9: 66,450,888 R2417L probably damaging Het
Hnrnpr A G 4: 136,317,175 probably benign Het
Igsf5 A T 16: 96,372,988 I73F probably damaging Het
Il17ra T C 6: 120,473,034 V91A probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 K548E probably damaging Het
Kdm5d T A Y: 941,515 C1239S probably damaging Het
Mamdc4 G A 2: 25,566,356 T709M probably benign Het
Mybbp1a T A 11: 72,444,721 Y353N probably damaging Het
Nepn A T 10: 52,391,759 E40D probably benign Het
Npat G T 9: 53,570,570 E1193* probably null Het
Nrde2 G A 12: 100,131,003 S846L probably benign Het
Nup205 T C 6: 35,225,203 V1290A probably benign Het
Olfr1009 T A 2: 85,721,501 L32Q probably null Het
Olfr1424 A G 19: 12,059,092 V220A probably benign Het
Olfr517 C A 7: 108,868,519 V212L probably benign Het
Pde6a A T 18: 61,220,696 K31M possibly damaging Het
Polr2g A T 19: 8,798,257 L30Q probably damaging Het
Prdm15 T A 16: 97,807,060 H679L probably damaging Het
Prl4a1 T G 13: 28,023,386 Y214* probably null Het
Prlr C T 15: 10,329,242 T601M possibly damaging Het
Psen2 A C 1: 180,245,691 S22A probably benign Het
Ralgapa1 C A 12: 55,722,914 R764L probably damaging Het
Scgb2b11 T C 7: 32,209,408 E89G probably damaging Het
Serpina10 T C 12: 103,628,277 I228V probably benign Het
Serpinb1a T A 13: 32,842,999 H320L probably damaging Het
Sesn2 C A 4: 132,498,053 Q267H possibly damaging Het
Sgsm1 A T 5: 113,251,011 W1019R probably damaging Het
Sqle A G 15: 59,321,302 probably null Het
Syt14 T C 1: 192,986,829 M39V probably benign Het
Tgm7 A G 2: 121,101,064 V206A probably damaging Het
Thbs4 T C 13: 92,760,586 probably null Het
Trpv1 T C 11: 73,254,251 F721S probably damaging Het
Ttll10 A T 4: 156,036,234 M433K probably benign Het
Vmn1r216 T C 13: 23,099,525 I126T probably benign Het
Vmn2r108 G A 17: 20,470,088 S494F probably benign Het
Vwa3b C T 1: 37,128,939 A603V probably benign Het
Xirp2 T A 2: 67,476,866 N19K probably damaging Het
Zfp397 T A 18: 23,960,722 N421K probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Pms2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:Pms2 APN 5 143923519 missense probably damaging 1.00
IGL02009:Pms2 APN 5 143925764 missense probably benign 0.42
IGL02801:Pms2 APN 5 143925835 missense probably benign 0.06
P0047:Pms2 UTSW 5 143919598 missense probably damaging 1.00
R1367:Pms2 UTSW 5 143925913 missense probably damaging 1.00
R1422:Pms2 UTSW 5 143913705 missense probably damaging 1.00
R1854:Pms2 UTSW 5 143925896 missense probably benign 0.08
R1997:Pms2 UTSW 5 143913700 missense probably damaging 1.00
R2248:Pms2 UTSW 5 143916506 missense probably damaging 1.00
R2873:Pms2 UTSW 5 143911914 splice site probably benign
R4072:Pms2 UTSW 5 143929001 missense probably damaging 0.99
R4082:Pms2 UTSW 5 143931019 missense probably damaging 1.00
R4358:Pms2 UTSW 5 143925926 missense probably damaging 1.00
R5100:Pms2 UTSW 5 143928188 missense probably damaging 1.00
R5101:Pms2 UTSW 5 143928188 missense probably damaging 1.00
R5228:Pms2 UTSW 5 143923597 missense probably damaging 0.99
R5484:Pms2 UTSW 5 143928125 missense probably damaging 1.00
R6310:Pms2 UTSW 5 143923583 missense probably benign 0.06
R6331:Pms2 UTSW 5 143914633 missense possibly damaging 0.94
R6567:Pms2 UTSW 5 143928968 missense probably damaging 0.99
R6718:Pms2 UTSW 5 143923489 missense probably damaging 0.98
R6747:Pms2 UTSW 5 143925419 missense probably benign 0.02
R6980:Pms2 UTSW 5 143912024 missense probably benign 0.21
R7207:Pms2 UTSW 5 143913634 missense probably damaging 1.00
R7349:Pms2 UTSW 5 143925836 missense probably benign 0.11
R7657:Pms2 UTSW 5 143919539 missense possibly damaging 0.93
R7820:Pms2 UTSW 5 143914633 missense possibly damaging 0.80
R7980:Pms2 UTSW 5 143931091 missense probably damaging 1.00
X0064:Pms2 UTSW 5 143916466 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTGACACTCTCTTACAGTGATG -3'
(R):5'- ATTGACAACCGCTGTGCCATC -3'

Sequencing Primer
(F):5'- GATGTCACTATATCTACCTGCCACGG -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On2020-07-13