Mutagenetix > Incidental Mutation

Incidental Mutation 'R8213:Nup205'

636253

Institutional Source

Beutler Lab

Gene Symbol

Nup205

Ensembl Gene

ENSMUSG00000038759

Gene Name

nucleoporin 205

Synonyms

3830404O05Rik

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_027513.1; MGI:2141625

Essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R8213 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

35177421-35247596 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 35225203 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1290 (V1290A)

Ref Sequence

ENSEMBL: ENSMUSP00000144126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043815] [ENSMUST00000170234] [ENSMUST00000201374]

AlphaFold

A0A0J9YUD5

Predicted Effect

probably benign
Transcript: ENSMUST00000043815
AA Change: V1237A

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000039656
Gene: ENSMUSG00000038759
AA Change: V1237A

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:Nup192	14	1684	N/A	PFAM
low complexity region	1995	2005	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170234

SMART Domains

Protein: ENSMUSP00000130033
Gene: ENSMUSG00000038759

Domain	Start	End	E-Value	Type
Pfam:DUF3414	13	322	9.7e-98	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000201374
AA Change: V1290A

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000144126
Gene: ENSMUSG00000038759
AA Change: V1290A

Domain	Start	End	E-Value	Type
low complexity region	36	50	N/A	INTRINSIC
Pfam:Nup192	67	1737	N/A	PFAM
low complexity region	2048	2058	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.1%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]

Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	C	15: 60,919,756	Y277C	probably damaging	Het
Acss1	T	A	2: 150,619,710	D651V	possibly damaging	Het
Aktip	G	T	8: 91,124,866	P243H	possibly damaging	Het
Arl11	T	G	14: 61,311,265	S175A	probably benign	Het
Aup1	A	G	6: 83,054,607		probably benign	Het
Avil	A	T	10: 127,008,321	I250F	probably damaging	Het
Btnl6	A	T	17: 34,508,883		probably null	Het
C77080	A	T	4: 129,221,459	V1070D	possibly damaging	Het
Ccdc7b	C	A	8: 129,178,291	Q137K	probably benign	Het
Cdk11b	G	A	4: 155,639,881	E319K	unknown	Het
Chka	A	C	19: 3,885,882	E196A	probably damaging	Het
Depdc5	C	T	5: 32,937,637	R753C	probably damaging	Het
Dhx57	T	A	17: 80,275,156	D340V	possibly damaging	Het
Dicer1	A	T	12: 104,702,693	D1243E	probably benign	Het
Dnajb9	A	T	12: 44,207,133	L164M	probably benign	Het
Dock6	A	G	9: 21,831,444	V785A	possibly damaging	Het
Efcab5	T	C	11: 77,116,071	Y909C	probably damaging	Het
Erp44	A	T	4: 48,208,783	S226T	probably benign	Het
Fgd6	A	T	10: 94,044,052	D256V	probably benign	Het
Fhl5	A	T	4: 25,207,113	Y218*	probably null	Het
Filip1	C	A	9: 79,818,092	A1082S	probably benign	Het
Gm13088	T	A	4: 143,654,185	M423L	probably benign	Het
Gm13128	A	T	4: 144,330,460	D71V	probably benign	Het
Heatr5a	G	A	12: 51,891,443	T1484M	probably damaging	Het
Herc1	G	T	9: 66,450,888	R2417L	probably damaging	Het
Hnrnpr	A	G	4: 136,317,175		probably benign	Het
Igsf5	A	T	16: 96,372,988	I73F	probably damaging	Het
Il17ra	T	C	6: 120,473,034	V91A	probably benign	Het
Inpp5f	A	G	7: 128,679,805	D510G	probably damaging	Het
Kbtbd3	A	G	9: 4,331,269	K548E	probably damaging	Het
Kdm5d	T	A	Y: 941,515	C1239S	probably damaging	Het
Mamdc4	G	A	2: 25,566,356	T709M	probably benign	Het
Mybbp1a	T	A	11: 72,444,721	Y353N	probably damaging	Het
Nepn	A	T	10: 52,391,759	E40D	probably benign	Het
Npat	G	T	9: 53,570,570	E1193*	probably null	Het
Nrde2	G	A	12: 100,131,003	S846L	probably benign	Het
Olfr1009	T	A	2: 85,721,501	L32Q	probably null	Het
Olfr1424	A	G	19: 12,059,092	V220A	probably benign	Het
Olfr517	C	A	7: 108,868,519	V212L	probably benign	Het
Pde6a	A	T	18: 61,220,696	K31M	possibly damaging	Het
Pms2	C	T	5: 143,914,771	R169C	probably damaging	Het
Polr2g	A	T	19: 8,798,257	L30Q	probably damaging	Het
Prdm15	T	A	16: 97,807,060	H679L	probably damaging	Het
Prl4a1	T	G	13: 28,023,386	Y214*	probably null	Het
Prlr	C	T	15: 10,329,242	T601M	possibly damaging	Het
Psen2	A	C	1: 180,245,691	S22A	probably benign	Het
Ralgapa1	C	A	12: 55,722,914	R764L	probably damaging	Het
Scgb2b11	T	C	7: 32,209,408	E89G	probably damaging	Het
Serpina10	T	C	12: 103,628,277	I228V	probably benign	Het
Serpinb1a	T	A	13: 32,842,999	H320L	probably damaging	Het
Sesn2	C	A	4: 132,498,053	Q267H	possibly damaging	Het
Sgsm1	A	T	5: 113,251,011	W1019R	probably damaging	Het
Sqle	A	G	15: 59,321,302		probably null	Het
Syt14	T	C	1: 192,986,829	M39V	probably benign	Het
Tgm7	A	G	2: 121,101,064	V206A	probably damaging	Het
Thbs4	T	C	13: 92,760,586		probably null	Het
Trpv1	T	C	11: 73,254,251	F721S	probably damaging	Het
Ttll10	A	T	4: 156,036,234	M433K	probably benign	Het
Vmn1r216	T	C	13: 23,099,525	I126T	probably benign	Het
Vmn2r108	G	A	17: 20,470,088	S494F	probably benign	Het
Vwa3b	C	T	1: 37,128,939	A603V	probably benign	Het
Xirp2	T	A	2: 67,476,866	N19K	probably damaging	Het
Zfp397	T	A	18: 23,960,722	N421K	probably damaging	Het
Zscan5b	C	T	7: 6,233,947	P232S	possibly damaging	Het

Other mutations in Nup205

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Nup205	APN	6	35214802	missense	probably damaging	1.00
IGL01086:Nup205	APN	6	35208936	splice site	probably benign
IGL01138:Nup205	APN	6	35208084	nonsense	probably null
IGL01333:Nup205	APN	6	35241063	missense	probably benign
IGL01399:Nup205	APN	6	35219689	missense	possibly damaging	0.80
IGL01466:Nup205	APN	6	35199959	missense	probably benign	0.08
IGL01913:Nup205	APN	6	35227430	missense	probably benign	0.10
IGL02159:Nup205	APN	6	35189178	missense	probably damaging	1.00
IGL02442:Nup205	APN	6	35190068	missense	probably benign	0.01
IGL02447:Nup205	APN	6	35227576	splice site	probably null
IGL02558:Nup205	APN	6	35189924	missense	probably damaging	1.00
IGL03306:Nup205	APN	6	35208169	missense	probably damaging	0.98
IGL03328:Nup205	APN	6	35232414	missense	probably damaging	0.99
Figaro	UTSW	6	35196714	splice site	probably null
Marcellina	UTSW	6	35183969	missense	probably damaging	1.00
Spirit	UTSW	6	35232408	missense	probably damaging	0.98
Susanna	UTSW	6	35208109	missense	possibly damaging	0.94
voyager	UTSW	6	35189885	missense	possibly damaging	0.80
BB007:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
BB017:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
P0012:Nup205	UTSW	6	35196543	missense	possibly damaging	0.90
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0362:Nup205	UTSW	6	35196714	splice site	probably null
R0374:Nup205	UTSW	6	35208837	missense	probably damaging	1.00
R0415:Nup205	UTSW	6	35214634	splice site	probably benign
R0427:Nup205	UTSW	6	35194463	missense	probably benign	0.01
R0543:Nup205	UTSW	6	35198969	missense	probably benign
R0611:Nup205	UTSW	6	35225968	missense	probably null	1.00
R0761:Nup205	UTSW	6	35196428	splice site	probably benign
R0828:Nup205	UTSW	6	35194566	missense	probably benign
R0906:Nup205	UTSW	6	35236892	missense	probably damaging	1.00
R1023:Nup205	UTSW	6	35234706	missense	probably damaging	0.98
R1033:Nup205	UTSW	6	35227442	missense	probably benign
R1375:Nup205	UTSW	6	35200071	splice site	probably benign
R1447:Nup205	UTSW	6	35215185	missense	probably benign	0.00
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1625:Nup205	UTSW	6	35191943	missense	probably benign	0.31
R1652:Nup205	UTSW	6	35238966	missense	probably benign
R1659:Nup205	UTSW	6	35234788	missense	probably benign	0.02
R1693:Nup205	UTSW	6	35210971	missense	probably benign	0.05
R1769:Nup205	UTSW	6	35205431	missense	probably damaging	1.00
R1839:Nup205	UTSW	6	35219714	missense	probably benign	0.00
R1959:Nup205	UTSW	6	35233366	missense	probably benign	0.16
R2051:Nup205	UTSW	6	35230516	missense	probably benign	0.29
R2267:Nup205	UTSW	6	35241349	missense	possibly damaging	0.67
R2401:Nup205	UTSW	6	35208134	nonsense	probably null
R3697:Nup205	UTSW	6	35188711	missense	probably benign	0.15
R3938:Nup205	UTSW	6	35219742	missense	probably damaging	1.00
R4074:Nup205	UTSW	6	35192040	critical splice donor site	probably null
R4117:Nup205	UTSW	6	35241012	nonsense	probably null
R4364:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4366:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4594:Nup205	UTSW	6	35196489	missense	probably benign	0.00
R4706:Nup205	UTSW	6	35202008	missense	probably damaging	1.00
R4787:Nup205	UTSW	6	35202061	missense	probably damaging	1.00
R4849:Nup205	UTSW	6	35230570	missense	possibly damaging	0.90
R4850:Nup205	UTSW	6	35230530	missense	probably benign	0.16
R4943:Nup205	UTSW	6	35224639	missense	probably damaging	1.00
R4966:Nup205	UTSW	6	35243849	missense	probably benign	0.00
R5138:Nup205	UTSW	6	35225866	missense	probably damaging	1.00
R5251:Nup205	UTSW	6	35196482	splice site	probably null
R5444:Nup205	UTSW	6	35189189	missense	probably damaging	0.98
R5760:Nup205	UTSW	6	35247343	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35227680	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35230548	missense	probably damaging	0.96
R5941:Nup205	UTSW	6	35232408	missense	probably damaging	0.98
R5969:Nup205	UTSW	6	35177578	unclassified	probably benign
R6003:Nup205	UTSW	6	35212816	missense	probably benign
R6178:Nup205	UTSW	6	35243843	missense	possibly damaging	0.85
R6315:Nup205	UTSW	6	35236869	missense	probably damaging	1.00
R6392:Nup205	UTSW	6	35189885	missense	possibly damaging	0.80
R6710:Nup205	UTSW	6	35247373	missense	probably benign	0.00
R6954:Nup205	UTSW	6	35208109	missense	possibly damaging	0.94
R7022:Nup205	UTSW	6	35243936	missense	probably benign	0.45
R7041:Nup205	UTSW	6	35224535	missense	possibly damaging	0.49
R7052:Nup205	UTSW	6	35215142	missense	possibly damaging	0.81
R7310:Nup205	UTSW	6	35225969	missense	possibly damaging	0.78
R7363:Nup205	UTSW	6	35232573	missense	probably benign	0.28
R7399:Nup205	UTSW	6	35214676	missense	probably damaging	0.99
R7428:Nup205	UTSW	6	35227559	missense	probably damaging	1.00
R7553:Nup205	UTSW	6	35201999	missense	probably damaging	1.00
R7665:Nup205	UTSW	6	35177620	missense	possibly damaging	0.46
R7841:Nup205	UTSW	6	35247437	missense	unknown
R7930:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
R7973:Nup205	UTSW	6	35245339	missense	probably benign
R7976:Nup205	UTSW	6	35198953	missense	probably damaging	1.00
R8073:Nup205	UTSW	6	35202169	critical splice donor site	probably null
R8080:Nup205	UTSW	6	35227376	missense	probably damaging	1.00
R8118:Nup205	UTSW	6	35230516	missense	probably benign	0.29
R8237:Nup205	UTSW	6	35227503	missense	possibly damaging	0.89
R8408:Nup205	UTSW	6	35225247	missense	probably damaging	1.00
R8807:Nup205	UTSW	6	35183969	missense	probably damaging	1.00
R8812:Nup205	UTSW	6	35214334	missense	probably damaging	1.00
R9061:Nup205	UTSW	6	35219873	intron	probably benign
R9261:Nup205	UTSW	6	35199857	missense	probably benign	0.00
R9403:Nup205	UTSW	6	35199974	missense	probably benign	0.45
R9648:Nup205	UTSW	6	35225811	missense	probably benign	0.00
R9744:Nup205	UTSW	6	35232575	missense	probably damaging	0.99
R9800:Nup205	UTSW	6	35186533	missense	possibly damaging	0.85
Z1177:Nup205	UTSW	6	35177605	missense	unknown
Z1177:Nup205	UTSW	6	35208793	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCTCCCAACATTAAATTACTGTCC -3'
(R):5'- GCCCTCTGTGTAAGTCATTGAC -3'

Sequencing Primer
(F):5'- CCCTGAGCTACTATTTTCTGGAAGG -3'
(R):5'- GTGTCAACCTAACACAGCT -3'

Posted On

2020-07-13