Incidental Mutation 'R8213:Aup1'
ID 636254
Institutional Source Beutler Lab
Gene Symbol Aup1
Ensembl Gene ENSMUSG00000068328
Gene Name ancient ubiquitous protein 1
Synonyms
MMRRC Submission 067655-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.308) question?
Stock # R8213 (G1)
Quality Score 113.008
Status Validated
Chromosome 6
Chromosomal Location 83031483-83034663 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 83031588 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000707] [ENSMUST00000077502] [ENSMUST00000089645] [ENSMUST00000092618] [ENSMUST00000101257] [ENSMUST00000113962] [ENSMUST00000122955] [ENSMUST00000134606] [ENSMUST00000113963] [ENSMUST00000204803]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000000707
SMART Domains Protein: ENSMUSP00000000707
Gene: ENSMUSG00000000693

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 408 3.72e-51 SMART
SR 418 526 8.5e-37 SMART
Pfam:Lysyl_oxidase 530 730 3.9e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077502
SMART Domains Protein: ENSMUSP00000076708
Gene: ENSMUSG00000009145

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DEXDc 30 236 5.01e-4 SMART
low complexity region 268 280 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
HA2 441 530 4e-19 SMART
Pfam:OB_NTP_bind 555 674 2.2e-11 PFAM
low complexity region 695 708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089645
SMART Domains Protein: ENSMUSP00000087073
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 341 1.1e-14 PFAM
Pfam:Trypsin_2 182 320 1.2e-34 PFAM
PDZ 371 445 2.86e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092618
SMART Domains Protein: ENSMUSP00000090281
Gene: ENSMUSG00000068328

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
PlsC 119 222 1.04e-1 SMART
low complexity region 307 322 N/A INTRINSIC
CUE 325 366 1.3e-9 SMART
low complexity region 378 392 N/A INTRINSIC
low complexity region 421 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101257
SMART Domains Protein: ENSMUSP00000098815
Gene: ENSMUSG00000000693

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 396 5.46e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113962
SMART Domains Protein: ENSMUSP00000109595
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin_2 182 237 2.7e-12 PFAM
Pfam:Trypsin 212 277 4.5e-6 PFAM
PDZ 285 348 4.89e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154829
Predicted Effect probably benign
Transcript: ENSMUST00000122955
SMART Domains Protein: ENSMUSP00000138153
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 321 2.1e-10 PFAM
Pfam:Trypsin_2 182 317 9.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184661
Predicted Effect probably benign
Transcript: ENSMUST00000134606
SMART Domains Protein: ENSMUSP00000115547
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
Pfam:Trypsin 7 180 2.7e-15 PFAM
Pfam:Trypsin_2 20 158 3.1e-24 PFAM
PDZ 209 283 2.86e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144058
Predicted Effect probably benign
Transcript: ENSMUST00000150217
SMART Domains Protein: ENSMUSP00000118234
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
Pfam:Trypsin 41 215 1.6e-11 PFAM
Pfam:Trypsin_2 53 190 1.8e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113963
SMART Domains Protein: ENSMUSP00000109596
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 342 6.8e-15 PFAM
Pfam:Trypsin_2 182 320 7.1e-24 PFAM
PDZ 350 413 4.89e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204281
Predicted Effect probably benign
Transcript: ENSMUST00000204719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205152
Predicted Effect probably benign
Transcript: ENSMUST00000203915
Predicted Effect probably benign
Transcript: ENSMUST00000204803
SMART Domains Protein: ENSMUSP00000144697
Gene: ENSMUSG00000009145

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DEXDc 30 236 2.1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203339
Predicted Effect probably benign
Transcript: ENSMUST00000204343
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: The protein encoded by this gene contains several conserved domains including a hydrophobic domain, an acetyltransferase domain, a ubiquitin binding domain, and a domain required for recruitment of ubiquitin-conjugating enzyme E2 G2 (Ube2g2). In humans, this protein localizes to the endoplasmic reticulum and to lipid droplets. This protein is thought to be involved both in the degradation of misfolded proteins from the endoplasmic reticulum and in the storage of neutral lipids. Reduced expression of the human ortholog of this gene strongly reduces lipid droplet clustering in the cell, and causes stabilization of misfolded proteins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,791,605 (GRCm39) Y277C probably damaging Het
Acss1 T A 2: 150,461,630 (GRCm39) D651V possibly damaging Het
Aktip G T 8: 91,851,494 (GRCm39) P243H possibly damaging Het
Arl11 T G 14: 61,548,714 (GRCm39) S175A probably benign Het
Avil A T 10: 126,844,190 (GRCm39) I250F probably damaging Het
Btnl6 A T 17: 34,727,857 (GRCm39) probably null Het
Ccdc7b C A 8: 129,904,772 (GRCm39) Q137K probably benign Het
Cdk11b G A 4: 155,724,338 (GRCm39) E319K unknown Het
Chka A C 19: 3,935,882 (GRCm39) E196A probably damaging Het
Depdc5 C T 5: 33,094,981 (GRCm39) R753C probably damaging Het
Dhx57 T A 17: 80,582,585 (GRCm39) D340V possibly damaging Het
Dicer1 A T 12: 104,668,952 (GRCm39) D1243E probably benign Het
Dnajb9 A T 12: 44,253,916 (GRCm39) L164M probably benign Het
Dock6 A G 9: 21,742,740 (GRCm39) V785A possibly damaging Het
Efcab5 T C 11: 77,006,897 (GRCm39) Y909C probably damaging Het
Erp44 A T 4: 48,208,783 (GRCm39) S226T probably benign Het
Fgd6 A T 10: 93,879,914 (GRCm39) D256V probably benign Het
Fhl5 A T 4: 25,207,113 (GRCm39) Y218* probably null Het
Filip1 C A 9: 79,725,374 (GRCm39) A1082S probably benign Het
Heatr5a G A 12: 51,938,226 (GRCm39) T1484M probably damaging Het
Herc1 G T 9: 66,358,170 (GRCm39) R2417L probably damaging Het
Hnrnpr A G 4: 136,044,486 (GRCm39) probably benign Het
Igsf5 A T 16: 96,174,188 (GRCm39) I73F probably damaging Het
Il17ra T C 6: 120,449,995 (GRCm39) V91A probably benign Het
Inpp5f A G 7: 128,281,529 (GRCm39) D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 (GRCm39) K548E probably damaging Het
Kdm5d T A Y: 941,515 (GRCm39) C1239S probably damaging Het
Mamdc4 G A 2: 25,456,368 (GRCm39) T709M probably benign Het
Mybbp1a T A 11: 72,335,547 (GRCm39) Y353N probably damaging Het
Nepn A T 10: 52,267,855 (GRCm39) E40D probably benign Het
Nhsl3 A T 4: 129,115,252 (GRCm39) V1070D possibly damaging Het
Npat G T 9: 53,481,870 (GRCm39) E1193* probably null Het
Nrde2 G A 12: 100,097,262 (GRCm39) S846L probably benign Het
Nup205 T C 6: 35,202,138 (GRCm39) V1290A probably benign Het
Or10a49 C A 7: 108,467,726 (GRCm39) V212L probably benign Het
Or4d10b A G 19: 12,036,456 (GRCm39) V220A probably benign Het
Or5g9 T A 2: 85,551,845 (GRCm39) L32Q probably null Het
Pde6a A T 18: 61,353,768 (GRCm39) K31M possibly damaging Het
Pms2 C T 5: 143,851,589 (GRCm39) R169C probably damaging Het
Polr2g A T 19: 8,775,621 (GRCm39) L30Q probably damaging Het
Pramel22 T A 4: 143,380,755 (GRCm39) M423L probably benign Het
Pramel30 A T 4: 144,057,030 (GRCm39) D71V probably benign Het
Prdm15 T A 16: 97,608,260 (GRCm39) H679L probably damaging Het
Prl4a1 T G 13: 28,207,369 (GRCm39) Y214* probably null Het
Prlr C T 15: 10,329,328 (GRCm39) T601M possibly damaging Het
Psen2 A C 1: 180,073,256 (GRCm39) S22A probably benign Het
Ralgapa1 C A 12: 55,769,699 (GRCm39) R764L probably damaging Het
Scgb2b11 T C 7: 31,908,833 (GRCm39) E89G probably damaging Het
Serpina10 T C 12: 103,594,536 (GRCm39) I228V probably benign Het
Serpinb1a T A 13: 33,026,982 (GRCm39) H320L probably damaging Het
Sesn2 C A 4: 132,225,364 (GRCm39) Q267H possibly damaging Het
Sgsm1 A T 5: 113,398,877 (GRCm39) W1019R probably damaging Het
Sqle A G 15: 59,193,151 (GRCm39) probably null Het
Syt14 T C 1: 192,669,137 (GRCm39) M39V probably benign Het
Tgm7 A G 2: 120,931,545 (GRCm39) V206A probably damaging Het
Thbs4 T C 13: 92,897,094 (GRCm39) probably null Het
Trpv1 T C 11: 73,145,077 (GRCm39) F721S probably damaging Het
Ttll10 A T 4: 156,120,691 (GRCm39) M433K probably benign Het
Vmn1r216 T C 13: 23,283,695 (GRCm39) I126T probably benign Het
Vmn2r108 G A 17: 20,690,350 (GRCm39) S494F probably benign Het
Vwa3b C T 1: 37,168,020 (GRCm39) A603V probably benign Het
Xirp2 T A 2: 67,307,210 (GRCm39) N19K probably damaging Het
Zfp397 T A 18: 24,093,779 (GRCm39) N421K probably damaging Het
Zscan5b C T 7: 6,236,946 (GRCm39) P232S possibly damaging Het
Other mutations in Aup1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Aup1 APN 6 83,033,390 (GRCm39) missense probably damaging 1.00
IGL02505:Aup1 APN 6 83,032,258 (GRCm39) missense probably benign 0.06
R0637:Aup1 UTSW 6 83,033,842 (GRCm39) missense probably damaging 1.00
R1544:Aup1 UTSW 6 83,032,187 (GRCm39) missense possibly damaging 0.84
R1686:Aup1 UTSW 6 83,032,226 (GRCm39) missense probably damaging 0.97
R4196:Aup1 UTSW 6 83,032,211 (GRCm39) missense probably damaging 1.00
R4512:Aup1 UTSW 6 83,033,368 (GRCm39) nonsense probably null
R5119:Aup1 UTSW 6 83,032,115 (GRCm39) missense probably damaging 0.96
R5387:Aup1 UTSW 6 83,032,005 (GRCm39) missense probably damaging 0.98
R6329:Aup1 UTSW 6 83,031,588 (GRCm39) unclassified probably benign
R6837:Aup1 UTSW 6 83,034,279 (GRCm39) missense possibly damaging 0.83
R7122:Aup1 UTSW 6 83,032,123 (GRCm39) missense probably benign 0.04
R7474:Aup1 UTSW 6 83,031,948 (GRCm39) missense probably benign 0.38
R7630:Aup1 UTSW 6 83,031,904 (GRCm39) missense unknown
R7701:Aup1 UTSW 6 83,032,908 (GRCm39) missense probably benign 0.21
R7747:Aup1 UTSW 6 83,031,776 (GRCm39) missense unknown
R8069:Aup1 UTSW 6 83,032,910 (GRCm39) nonsense probably null
R8732:Aup1 UTSW 6 83,033,602 (GRCm39) missense probably damaging 0.99
Z1176:Aup1 UTSW 6 83,033,614 (GRCm39) missense probably benign 0.00
Z1177:Aup1 UTSW 6 83,034,505 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGTTCCTGACGTCAGCAGAG -3'
(R):5'- TTACCGGTGCGAGTCAAAGAG -3'

Sequencing Primer
(F):5'- AAGGCTCCAGTTTGCACC -3'
(R):5'- AGTCAAAGAGCCGCTCCG -3'
Posted On 2020-07-13