Mutagenetix > Incidental Mutation

Incidental Mutation 'R8213:Il17ra'

636255

Institutional Source

Beutler Lab

Gene Symbol

Il17ra

Ensembl Gene

ENSMUSG00000002897

Gene Name

interleukin 17 receptor A

Synonyms

VDw217, Il17r

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R8213 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120463247-120487559 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120473034 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 91 (V91A)

Ref Sequence

ENSEMBL: ENSMUSP00000002976 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002976]

AlphaFold

Q60943

Predicted Effect

probably benign
Transcript: ENSMUST00000002976
AA Change: V91A

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000002976
Gene: ENSMUSG00000002897
AA Change: V91A

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Pfam:IL17R_fnIII_D1	48	198	1.3e-70	PFAM
Pfam:IL17R_fnIII_D2	199	303	9.6e-53	PFAM
transmembrane domain	321	343	N/A	INTRINSIC
Pfam:SEFIR	380	539	1.5e-51	PFAM
low complexity region	747	765	N/A	INTRINSIC
low complexity region	801	830	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.1%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interleukin 17A (IL17A) is a proinflammatory cytokine secreted by activated T-lymphocytes. It is a potent inducer of the maturation of CD34-positive hematopoietic precursors into neutrophils. The transmembrane protein encoded by this gene (interleukin 17A receptor; IL17RA) is a ubiquitous type I membrane glycoprotein that binds with low affinity to interleukin 17A. Interleukin 17A and its receptor play a pathogenic role in many inflammatory and autoimmune diseases such as rheumatoid arthritis. Like other cytokine receptors, this receptor likely has a multimeric structure. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed neutrophil recruitment and enhanced susceptibility to intranasal infection by Klibsiella pneumoniae. Mice homozygous for a different knock-out allele exhibit delayed and milder IMQ-induced psoriasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	C	15: 60,919,756	Y277C	probably damaging	Het
Acss1	T	A	2: 150,619,710	D651V	possibly damaging	Het
Aktip	G	T	8: 91,124,866	P243H	possibly damaging	Het
Arl11	T	G	14: 61,311,265	S175A	probably benign	Het
Aup1	A	G	6: 83,054,607		probably benign	Het
Avil	A	T	10: 127,008,321	I250F	probably damaging	Het
Btnl6	A	T	17: 34,508,883		probably null	Het
C77080	A	T	4: 129,221,459	V1070D	possibly damaging	Het
Ccdc7b	C	A	8: 129,178,291	Q137K	probably benign	Het
Cdk11b	G	A	4: 155,639,881	E319K	unknown	Het
Chka	A	C	19: 3,885,882	E196A	probably damaging	Het
Depdc5	C	T	5: 32,937,637	R753C	probably damaging	Het
Dhx57	T	A	17: 80,275,156	D340V	possibly damaging	Het
Dicer1	A	T	12: 104,702,693	D1243E	probably benign	Het
Dnajb9	A	T	12: 44,207,133	L164M	probably benign	Het
Dock6	A	G	9: 21,831,444	V785A	possibly damaging	Het
Efcab5	T	C	11: 77,116,071	Y909C	probably damaging	Het
Erp44	A	T	4: 48,208,783	S226T	probably benign	Het
Fgd6	A	T	10: 94,044,052	D256V	probably benign	Het
Fhl5	A	T	4: 25,207,113	Y218*	probably null	Het
Filip1	C	A	9: 79,818,092	A1082S	probably benign	Het
Gm13088	T	A	4: 143,654,185	M423L	probably benign	Het
Gm13128	A	T	4: 144,330,460	D71V	probably benign	Het
Heatr5a	G	A	12: 51,891,443	T1484M	probably damaging	Het
Herc1	G	T	9: 66,450,888	R2417L	probably damaging	Het
Hnrnpr	A	G	4: 136,317,175		probably benign	Het
Igsf5	A	T	16: 96,372,988	I73F	probably damaging	Het
Inpp5f	A	G	7: 128,679,805	D510G	probably damaging	Het
Kbtbd3	A	G	9: 4,331,269	K548E	probably damaging	Het
Kdm5d	T	A	Y: 941,515	C1239S	probably damaging	Het
Mamdc4	G	A	2: 25,566,356	T709M	probably benign	Het
Mybbp1a	T	A	11: 72,444,721	Y353N	probably damaging	Het
Nepn	A	T	10: 52,391,759	E40D	probably benign	Het
Npat	G	T	9: 53,570,570	E1193*	probably null	Het
Nrde2	G	A	12: 100,131,003	S846L	probably benign	Het
Nup205	T	C	6: 35,225,203	V1290A	probably benign	Het
Olfr1009	T	A	2: 85,721,501	L32Q	probably null	Het
Olfr1424	A	G	19: 12,059,092	V220A	probably benign	Het
Olfr517	C	A	7: 108,868,519	V212L	probably benign	Het
Pde6a	A	T	18: 61,220,696	K31M	possibly damaging	Het
Pms2	C	T	5: 143,914,771	R169C	probably damaging	Het
Polr2g	A	T	19: 8,798,257	L30Q	probably damaging	Het
Prdm15	T	A	16: 97,807,060	H679L	probably damaging	Het
Prl4a1	T	G	13: 28,023,386	Y214*	probably null	Het
Prlr	C	T	15: 10,329,242	T601M	possibly damaging	Het
Psen2	A	C	1: 180,245,691	S22A	probably benign	Het
Ralgapa1	C	A	12: 55,722,914	R764L	probably damaging	Het
Scgb2b11	T	C	7: 32,209,408	E89G	probably damaging	Het
Serpina10	T	C	12: 103,628,277	I228V	probably benign	Het
Serpinb1a	T	A	13: 32,842,999	H320L	probably damaging	Het
Sesn2	C	A	4: 132,498,053	Q267H	possibly damaging	Het
Sgsm1	A	T	5: 113,251,011	W1019R	probably damaging	Het
Sqle	A	G	15: 59,321,302		probably null	Het
Syt14	T	C	1: 192,986,829	M39V	probably benign	Het
Tgm7	A	G	2: 121,101,064	V206A	probably damaging	Het
Thbs4	T	C	13: 92,760,586		probably null	Het
Trpv1	T	C	11: 73,254,251	F721S	probably damaging	Het
Ttll10	A	T	4: 156,036,234	M433K	probably benign	Het
Vmn1r216	T	C	13: 23,099,525	I126T	probably benign	Het
Vmn2r108	G	A	17: 20,470,088	S494F	probably benign	Het
Vwa3b	C	T	1: 37,128,939	A603V	probably benign	Het
Xirp2	T	A	2: 67,476,866	N19K	probably damaging	Het
Zfp397	T	A	18: 23,960,722	N421K	probably damaging	Het
Zscan5b	C	T	7: 6,233,947	P232S	possibly damaging	Het

Other mutations in Il17ra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01367:Il17ra	APN	6	120481465	missense	probably damaging	1.00
IGL01413:Il17ra	APN	6	120475581	missense	probably benign	0.00
IGL01418:Il17ra	APN	6	120475581	missense	probably benign	0.00
IGL03215:Il17ra	APN	6	120472114	missense	probably damaging	1.00
IGL03047:Il17ra	UTSW	6	120481226	missense	probably damaging	1.00
PIT4305001:Il17ra	UTSW	6	120481406	missense	probably damaging	1.00
R0042:Il17ra	UTSW	6	120472125	splice site	probably benign
R0042:Il17ra	UTSW	6	120472125	splice site	probably benign
R0365:Il17ra	UTSW	6	120478449	missense	probably benign	0.03
R0391:Il17ra	UTSW	6	120476979	splice site	probably benign
R0470:Il17ra	UTSW	6	120481806	missense	probably benign	0.01
R0599:Il17ra	UTSW	6	120481505	missense	probably damaging	1.00
R1525:Il17ra	UTSW	6	120473790	missense	probably damaging	0.98
R1900:Il17ra	UTSW	6	120477394	critical splice acceptor site	probably null
R1972:Il17ra	UTSW	6	120482216	missense	probably benign	0.01
R4192:Il17ra	UTSW	6	120481511	missense	probably damaging	1.00
R4923:Il17ra	UTSW	6	120477445	missense	possibly damaging	0.94
R5009:Il17ra	UTSW	6	120482207	missense	probably benign	0.00
R5133:Il17ra	UTSW	6	120481553	missense	possibly damaging	0.81
R5411:Il17ra	UTSW	6	120481442	missense	probably damaging	1.00
R5548:Il17ra	UTSW	6	120478473	missense	probably benign	0.23
R6137:Il17ra	UTSW	6	120475582	missense	probably benign	0.23
R6190:Il17ra	UTSW	6	120475273	missense	probably damaging	1.00
R7202:Il17ra	UTSW	6	120475611	missense	probably benign	0.01
R7300:Il17ra	UTSW	6	120482102	missense	probably benign	0.00
R8130:Il17ra	UTSW	6	120478455	missense	probably benign	0.01
R8152:Il17ra	UTSW	6	120482102	missense	probably benign	0.00
R8525:Il17ra	UTSW	6	120474337	nonsense	probably null
R8560:Il17ra	UTSW	6	120482265	missense	possibly damaging	0.78
R8675:Il17ra	UTSW	6	120481988	missense	probably benign	0.05
R8754:Il17ra	UTSW	6	120481456	missense	probably benign	0.09
R8956:Il17ra	UTSW	6	120481504	missense	probably damaging	1.00
R9419:Il17ra	UTSW	6	120481294	missense	possibly damaging	0.63
R9478:Il17ra	UTSW	6	120474375	missense	possibly damaging	0.83
R9742:Il17ra	UTSW	6	120481505	missense	probably damaging	1.00
R9790:Il17ra	UTSW	6	120482279	missense	probably damaging	1.00
R9791:Il17ra	UTSW	6	120482279	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACTCATAGCAGGTCTCTGGAC -3'
(R):5'- TGATGCAAGGGAAGGCCTTTC -3'

Sequencing Primer
(F):5'- GTCTCTGGACCCTCTAAGCAG -3'
(R):5'- GGCCTTTCATAAAGACAGTGTG -3'

Posted On

2020-07-13