Incidental Mutation 'R8213:Scgb2b11'
List |< first << previous [record 49 of 65] next >> last >|
ID636257
Institutional Source Beutler Lab
Gene Symbol Scgb2b11
Ensembl Gene ENSMUSG00000099729
Gene Namesecretoglobin, family 2B, member 11
SynonymsGm4687, Abpbg11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R8213 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location32209173-32211145 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32209408 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 89 (E89G)
Ref Sequence ENSEMBL: ENSMUSP00000140470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000188293]
Predicted Effect probably damaging
Transcript: ENSMUST00000188293
AA Change: E89G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140470
Gene: ENSMUSG00000099729
AA Change: E89G

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:Feld-I_B 24 90 4.9e-34 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,756 Y277C probably damaging Het
Acss1 T A 2: 150,619,710 D651V possibly damaging Het
Aktip G T 8: 91,124,866 P243H possibly damaging Het
Arl11 T G 14: 61,311,265 S175A probably benign Het
Aup1 A G 6: 83,054,607 probably benign Het
Avil A T 10: 127,008,321 I250F probably damaging Het
Btnl6 A T 17: 34,508,883 probably null Het
C77080 A T 4: 129,221,459 V1070D possibly damaging Het
Ccdc7b C A 8: 129,178,291 Q137K probably benign Het
Cdk11b G A 4: 155,639,881 E319K unknown Het
Chka A C 19: 3,885,882 E196A probably damaging Het
Depdc5 C T 5: 32,937,637 R753C probably damaging Het
Dhx57 T A 17: 80,275,156 D340V possibly damaging Het
Dicer1 A T 12: 104,702,693 D1243E probably benign Het
Dnajb9 A T 12: 44,207,133 L164M probably benign Het
Dock6 A G 9: 21,831,444 V785A possibly damaging Het
Efcab5 T C 11: 77,116,071 Y909C probably damaging Het
Erp44 A T 4: 48,208,783 S226T probably benign Het
Fgd6 A T 10: 94,044,052 D256V probably benign Het
Fhl5 A T 4: 25,207,113 Y218* probably null Het
Filip1 C A 9: 79,818,092 A1082S probably benign Het
Gm13088 T A 4: 143,654,185 M423L probably benign Het
Gm13128 A T 4: 144,330,460 D71V probably benign Het
Heatr5a G A 12: 51,891,443 T1484M probably damaging Het
Herc1 G T 9: 66,450,888 R2417L probably damaging Het
Hnrnpr A G 4: 136,317,175 probably benign Het
Igsf5 A T 16: 96,372,988 I73F probably damaging Het
Il17ra T C 6: 120,473,034 V91A probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 K548E probably damaging Het
Kdm5d T A Y: 941,515 C1239S probably damaging Het
Mamdc4 G A 2: 25,566,356 T709M probably benign Het
Mybbp1a T A 11: 72,444,721 Y353N probably damaging Het
Nepn A T 10: 52,391,759 E40D probably benign Het
Npat G T 9: 53,570,570 E1193* probably null Het
Nrde2 G A 12: 100,131,003 S846L probably benign Het
Nup205 T C 6: 35,225,203 V1290A probably benign Het
Olfr1009 T A 2: 85,721,501 L32Q probably null Het
Olfr1424 A G 19: 12,059,092 V220A probably benign Het
Olfr517 C A 7: 108,868,519 V212L probably benign Het
Pde6a A T 18: 61,220,696 K31M possibly damaging Het
Pms2 C T 5: 143,914,771 R169C probably damaging Het
Polr2g A T 19: 8,798,257 L30Q probably damaging Het
Prdm15 T A 16: 97,807,060 H679L probably damaging Het
Prl4a1 T G 13: 28,023,386 Y214* probably null Het
Prlr C T 15: 10,329,242 T601M possibly damaging Het
Psen2 A C 1: 180,245,691 S22A probably benign Het
Ralgapa1 C A 12: 55,722,914 R764L probably damaging Het
Serpina10 T C 12: 103,628,277 I228V probably benign Het
Serpinb1a T A 13: 32,842,999 H320L probably damaging Het
Sesn2 C A 4: 132,498,053 Q267H possibly damaging Het
Sgsm1 A T 5: 113,251,011 W1019R probably damaging Het
Sqle A G 15: 59,321,302 probably null Het
Syt14 T C 1: 192,986,829 M39V probably benign Het
Tgm7 A G 2: 121,101,064 V206A probably damaging Het
Thbs4 T C 13: 92,760,586 probably null Het
Trpv1 T C 11: 73,254,251 F721S probably damaging Het
Ttll10 A T 4: 156,036,234 M433K probably benign Het
Vmn1r216 T C 13: 23,099,525 I126T probably benign Het
Vmn2r108 G A 17: 20,470,088 S494F probably benign Het
Vwa3b C T 1: 37,128,939 A603V probably benign Het
Xirp2 T A 2: 67,476,866 N19K probably damaging Het
Zfp397 T A 18: 23,960,722 N421K probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Scgb2b11
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5262:Scgb2b11 UTSW 7 32209351 missense probably benign 0.07
R7055:Scgb2b11 UTSW 7 32210482 missense possibly damaging 0.83
R7140:Scgb2b11 UTSW 7 32210581 missense probably damaging 1.00
R7660:Scgb2b11 UTSW 7 32210458 missense probably damaging 1.00
R7853:Scgb2b11 UTSW 7 32209382 missense probably damaging 0.98
R8252:Scgb2b11 UTSW 7 32209339 missense probably benign 0.41
Z1177:Scgb2b11 UTSW 7 32210592 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGTCACAGAACAGAGTTGC -3'
(R):5'- TTCCCTTGAGGCAGAACTTG -3'

Sequencing Primer
(F):5'- TGAAGGAACAGTATCAGGAATCCTAC -3'
(R):5'- CCCTTGAGGCAGAACTTGTTACTAG -3'
Posted On2020-07-13