Mutagenetix > Incidental Mutation

Incidental Mutation 'R8213:Aktip'

636260

Institutional Source

Beutler Lab

Gene Symbol

Aktip

Ensembl Gene

ENSMUSG00000031667

Gene Name

thymoma viral proto-oncogene 1 interacting protein

Synonyms

Ft1

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8213 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

91111784-91199976 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 91124866 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Histidine at position 243 (P243H)

Ref Sequence

ENSEMBL: ENSMUSP00000105238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034091] [ENSMUST00000109609] [ENSMUST00000120213] [ENSMUST00000120349] [ENSMUST00000120426] [ENSMUST00000125257] [ENSMUST00000209311] [ENSMUST00000209444] [ENSMUST00000209518] [ENSMUST00000211136]

AlphaFold

Q64362

Predicted Effect

probably benign
Transcript: ENSMUST00000034091

SMART Domains

Protein: ENSMUSP00000034091
Gene: ENSMUSG00000031666

Domain	Start	End	E-Value	Type
low complexity region	8	30	N/A	INTRINSIC
CYCLIN	44	131	5.81e-1	SMART
DUF3452	94	236	2.36e-77	SMART
low complexity region	301	313	N/A	INTRINSIC
RB_A	414	606	3.42e-106	SMART
low complexity region	722	733	N/A	INTRINSIC
low complexity region	758	771	N/A	INTRINSIC
low complexity region	776	789	N/A	INTRINSIC
low complexity region	804	818	N/A	INTRINSIC
CYCLIN	845	1008	2.86e-6	SMART
Rb_C	1019	1135	5.42e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109609
AA Change: P243H

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000105238
Gene: ENSMUSG00000031667
AA Change: P243H

Domain	Start	End	E-Value	Type
UBCc	77	222	3.97e-31	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120213
AA Change: P243H

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000112375
Gene: ENSMUSG00000031667
AA Change: P243H

Domain	Start	End	E-Value	Type
UBCc	77	222	3.97e-31	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120349
AA Change: P243H

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000113769
Gene: ENSMUSG00000031667
AA Change: P243H

Domain	Start	End	E-Value	Type
UBCc	77	222	3.97e-31	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000113379
Gene: ENSMUSG00000031667
AA Change: P243H

Domain	Start	End	E-Value	Type
UBCc	77	222	3.97e-31	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000125257
AA Change: P243H

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000119277
Gene: ENSMUSG00000031667
AA Change: P243H

Domain	Start	End	E-Value	Type
UBCc	77	222	3.97e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000209311

Predicted Effect

probably benign
Transcript: ENSMUST00000209444

Predicted Effect

probably benign
Transcript: ENSMUST00000209518

Predicted Effect

probably benign
Transcript: ENSMUST00000211050

Predicted Effect

probably benign
Transcript: ENSMUST00000211136

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.1%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mouse homolog of this gene produces fused toes and thymic hyperplasia in heterozygous mutant animals while homozygous mutants die in early development. This gene may play a role in apoptosis as these morphological abnormalities are caused by altered patterns of programmed cell death. The protein encoded by this gene is similar to the ubiquitin ligase domain of other ubiquitin-conjugating enzymes but lacks the conserved cysteine residue that enables those enzymes to conjugate ubiquitin to the target protein. This protein interacts directly with serine/threonine kinase protein kinase B (PKB)/Akt and modulates PKB activity by enhancing the phosphorylation of PKB's regulatory sites. Alternative splicing results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	C	15: 60,919,756	Y277C	probably damaging	Het
Acss1	T	A	2: 150,619,710	D651V	possibly damaging	Het
Arl11	T	G	14: 61,311,265	S175A	probably benign	Het
Aup1	A	G	6: 83,054,607		probably benign	Het
Avil	A	T	10: 127,008,321	I250F	probably damaging	Het
Btnl6	A	T	17: 34,508,883		probably null	Het
C77080	A	T	4: 129,221,459	V1070D	possibly damaging	Het
Ccdc7b	C	A	8: 129,178,291	Q137K	probably benign	Het
Cdk11b	G	A	4: 155,639,881	E319K	unknown	Het
Chka	A	C	19: 3,885,882	E196A	probably damaging	Het
Depdc5	C	T	5: 32,937,637	R753C	probably damaging	Het
Dhx57	T	A	17: 80,275,156	D340V	possibly damaging	Het
Dicer1	A	T	12: 104,702,693	D1243E	probably benign	Het
Dnajb9	A	T	12: 44,207,133	L164M	probably benign	Het
Dock6	A	G	9: 21,831,444	V785A	possibly damaging	Het
Efcab5	T	C	11: 77,116,071	Y909C	probably damaging	Het
Erp44	A	T	4: 48,208,783	S226T	probably benign	Het
Fgd6	A	T	10: 94,044,052	D256V	probably benign	Het
Fhl5	A	T	4: 25,207,113	Y218*	probably null	Het
Filip1	C	A	9: 79,818,092	A1082S	probably benign	Het
Gm13088	T	A	4: 143,654,185	M423L	probably benign	Het
Gm13128	A	T	4: 144,330,460	D71V	probably benign	Het
Heatr5a	G	A	12: 51,891,443	T1484M	probably damaging	Het
Herc1	G	T	9: 66,450,888	R2417L	probably damaging	Het
Hnrnpr	A	G	4: 136,317,175		probably benign	Het
Igsf5	A	T	16: 96,372,988	I73F	probably damaging	Het
Il17ra	T	C	6: 120,473,034	V91A	probably benign	Het
Inpp5f	A	G	7: 128,679,805	D510G	probably damaging	Het
Kbtbd3	A	G	9: 4,331,269	K548E	probably damaging	Het
Kdm5d	T	A	Y: 941,515	C1239S	probably damaging	Het
Mamdc4	G	A	2: 25,566,356	T709M	probably benign	Het
Mybbp1a	T	A	11: 72,444,721	Y353N	probably damaging	Het
Nepn	A	T	10: 52,391,759	E40D	probably benign	Het
Npat	G	T	9: 53,570,570	E1193*	probably null	Het
Nrde2	G	A	12: 100,131,003	S846L	probably benign	Het
Nup205	T	C	6: 35,225,203	V1290A	probably benign	Het
Olfr1009	T	A	2: 85,721,501	L32Q	probably null	Het
Olfr1424	A	G	19: 12,059,092	V220A	probably benign	Het
Olfr517	C	A	7: 108,868,519	V212L	probably benign	Het
Pde6a	A	T	18: 61,220,696	K31M	possibly damaging	Het
Pms2	C	T	5: 143,914,771	R169C	probably damaging	Het
Polr2g	A	T	19: 8,798,257	L30Q	probably damaging	Het
Prdm15	T	A	16: 97,807,060	H679L	probably damaging	Het
Prl4a1	T	G	13: 28,023,386	Y214*	probably null	Het
Prlr	C	T	15: 10,329,242	T601M	possibly damaging	Het
Psen2	A	C	1: 180,245,691	S22A	probably benign	Het
Ralgapa1	C	A	12: 55,722,914	R764L	probably damaging	Het
Scgb2b11	T	C	7: 32,209,408	E89G	probably damaging	Het
Serpina10	T	C	12: 103,628,277	I228V	probably benign	Het
Serpinb1a	T	A	13: 32,842,999	H320L	probably damaging	Het
Sesn2	C	A	4: 132,498,053	Q267H	possibly damaging	Het
Sgsm1	A	T	5: 113,251,011	W1019R	probably damaging	Het
Sqle	A	G	15: 59,321,302		probably null	Het
Syt14	T	C	1: 192,986,829	M39V	probably benign	Het
Tgm7	A	G	2: 121,101,064	V206A	probably damaging	Het
Thbs4	T	C	13: 92,760,586		probably null	Het
Trpv1	T	C	11: 73,254,251	F721S	probably damaging	Het
Ttll10	A	T	4: 156,036,234	M433K	probably benign	Het
Vmn1r216	T	C	13: 23,099,525	I126T	probably benign	Het
Vmn2r108	G	A	17: 20,470,088	S494F	probably benign	Het
Vwa3b	C	T	1: 37,128,939	A603V	probably benign	Het
Xirp2	T	A	2: 67,476,866	N19K	probably damaging	Het
Zfp397	T	A	18: 23,960,722	N421K	probably damaging	Het
Zscan5b	C	T	7: 6,233,947	P232S	possibly damaging	Het

Other mutations in Aktip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01958:Aktip	APN	8	91126225	missense	probably damaging	1.00
IGL02351:Aktip	APN	8	91126892	missense	possibly damaging	0.73
IGL02358:Aktip	APN	8	91126892	missense	possibly damaging	0.73
IGL03085:Aktip	APN	8	91126023	critical splice donor site	probably null
R1564:Aktip	UTSW	8	91131081	start codon destroyed	probably null	0.94
R1809:Aktip	UTSW	8	91129720	missense	probably damaging	1.00
R1851:Aktip	UTSW	8	91125877	missense	possibly damaging	0.93
R4067:Aktip	UTSW	8	91125838	missense	possibly damaging	0.87
R4455:Aktip	UTSW	8	91124851	missense	probably benign	0.00
R5052:Aktip	UTSW	8	91129651	missense	possibly damaging	0.47
R5330:Aktip	UTSW	8	91126724	missense	probably damaging	0.98
R6134:Aktip	UTSW	8	91129760	missense	probably damaging	1.00
R6178:Aktip	UTSW	8	91126043	missense	probably damaging	0.98
R6984:Aktip	UTSW	8	91126718	missense	probably damaging	1.00
R7672:Aktip	UTSW	8	91129657	missense	possibly damaging	0.67
R8386:Aktip	UTSW	8	91131046	missense	probably benign	0.04
R8850:Aktip	UTSW	8	91126774	missense	probably benign	0.00
R9712:Aktip	UTSW	8	91129727	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCATCAGGCTTCTTCTGGG -3'
(R):5'- GCTCTTTAGCCAGGGATATGGG -3'

Sequencing Primer
(F):5'- AGGCTTCTTCTGGGCACAATC -3'
(R):5'- CAGGCCCGCATTTAAGGCTAAG -3'

Posted On

2020-07-13