Incidental Mutation 'R8213:Aktip'
ID636260
Institutional Source Beutler Lab
Gene Symbol Aktip
Ensembl Gene ENSMUSG00000031667
Gene Namethymoma viral proto-oncogene 1 interacting protein
SynonymsFt1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8213 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location91111784-91199976 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 91124866 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 243 (P243H)
Ref Sequence ENSEMBL: ENSMUSP00000105238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034091] [ENSMUST00000109609] [ENSMUST00000120213] [ENSMUST00000120349] [ENSMUST00000120426] [ENSMUST00000125257] [ENSMUST00000209311] [ENSMUST00000209444] [ENSMUST00000209518] [ENSMUST00000211136]
Predicted Effect probably benign
Transcript: ENSMUST00000034091
SMART Domains Protein: ENSMUSP00000034091
Gene: ENSMUSG00000031666

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
CYCLIN 44 131 5.81e-1 SMART
DUF3452 94 236 2.36e-77 SMART
low complexity region 301 313 N/A INTRINSIC
RB_A 414 606 3.42e-106 SMART
low complexity region 722 733 N/A INTRINSIC
low complexity region 758 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
CYCLIN 845 1008 2.86e-6 SMART
Rb_C 1019 1135 5.42e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109609
AA Change: P243H

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105238
Gene: ENSMUSG00000031667
AA Change: P243H

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120213
AA Change: P243H

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112375
Gene: ENSMUSG00000031667
AA Change: P243H

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120349
AA Change: P243H

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113769
Gene: ENSMUSG00000031667
AA Change: P243H

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000113379
Gene: ENSMUSG00000031667
AA Change: P243H

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125257
AA Change: P243H

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119277
Gene: ENSMUSG00000031667
AA Change: P243H

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209311
Predicted Effect probably benign
Transcript: ENSMUST00000209444
Predicted Effect probably benign
Transcript: ENSMUST00000209518
Predicted Effect probably benign
Transcript: ENSMUST00000211050
Predicted Effect probably benign
Transcript: ENSMUST00000211136
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mouse homolog of this gene produces fused toes and thymic hyperplasia in heterozygous mutant animals while homozygous mutants die in early development. This gene may play a role in apoptosis as these morphological abnormalities are caused by altered patterns of programmed cell death. The protein encoded by this gene is similar to the ubiquitin ligase domain of other ubiquitin-conjugating enzymes but lacks the conserved cysteine residue that enables those enzymes to conjugate ubiquitin to the target protein. This protein interacts directly with serine/threonine kinase protein kinase B (PKB)/Akt and modulates PKB activity by enhancing the phosphorylation of PKB's regulatory sites. Alternative splicing results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,756 Y277C probably damaging Het
Acss1 T A 2: 150,619,710 D651V possibly damaging Het
Arl11 T G 14: 61,311,265 S175A probably benign Het
Aup1 A G 6: 83,054,607 probably benign Het
Avil A T 10: 127,008,321 I250F probably damaging Het
Btnl6 A T 17: 34,508,883 probably null Het
C77080 A T 4: 129,221,459 V1070D possibly damaging Het
Ccdc7b C A 8: 129,178,291 Q137K probably benign Het
Cdk11b G A 4: 155,639,881 E319K unknown Het
Chka A C 19: 3,885,882 E196A probably damaging Het
Depdc5 C T 5: 32,937,637 R753C probably damaging Het
Dhx57 T A 17: 80,275,156 D340V possibly damaging Het
Dicer1 A T 12: 104,702,693 D1243E probably benign Het
Dnajb9 A T 12: 44,207,133 L164M probably benign Het
Dock6 A G 9: 21,831,444 V785A possibly damaging Het
Efcab5 T C 11: 77,116,071 Y909C probably damaging Het
Erp44 A T 4: 48,208,783 S226T probably benign Het
Fgd6 A T 10: 94,044,052 D256V probably benign Het
Fhl5 A T 4: 25,207,113 Y218* probably null Het
Filip1 C A 9: 79,818,092 A1082S probably benign Het
Gm13088 T A 4: 143,654,185 M423L probably benign Het
Gm13128 A T 4: 144,330,460 D71V probably benign Het
Heatr5a G A 12: 51,891,443 T1484M probably damaging Het
Herc1 G T 9: 66,450,888 R2417L probably damaging Het
Hnrnpr A G 4: 136,317,175 probably benign Het
Igsf5 A T 16: 96,372,988 I73F probably damaging Het
Il17ra T C 6: 120,473,034 V91A probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 K548E probably damaging Het
Kdm5d T A Y: 941,515 C1239S probably damaging Het
Mamdc4 G A 2: 25,566,356 T709M probably benign Het
Mybbp1a T A 11: 72,444,721 Y353N probably damaging Het
Nepn A T 10: 52,391,759 E40D probably benign Het
Npat G T 9: 53,570,570 E1193* probably null Het
Nrde2 G A 12: 100,131,003 S846L probably benign Het
Nup205 T C 6: 35,225,203 V1290A probably benign Het
Olfr1009 T A 2: 85,721,501 L32Q probably null Het
Olfr1424 A G 19: 12,059,092 V220A probably benign Het
Olfr517 C A 7: 108,868,519 V212L probably benign Het
Pde6a A T 18: 61,220,696 K31M possibly damaging Het
Pms2 C T 5: 143,914,771 R169C probably damaging Het
Polr2g A T 19: 8,798,257 L30Q probably damaging Het
Prdm15 T A 16: 97,807,060 H679L probably damaging Het
Prl4a1 T G 13: 28,023,386 Y214* probably null Het
Prlr C T 15: 10,329,242 T601M possibly damaging Het
Psen2 A C 1: 180,245,691 S22A probably benign Het
Ralgapa1 C A 12: 55,722,914 R764L probably damaging Het
Scgb2b11 T C 7: 32,209,408 E89G probably damaging Het
Serpina10 T C 12: 103,628,277 I228V probably benign Het
Serpinb1a T A 13: 32,842,999 H320L probably damaging Het
Sesn2 C A 4: 132,498,053 Q267H possibly damaging Het
Sgsm1 A T 5: 113,251,011 W1019R probably damaging Het
Sqle A G 15: 59,321,302 probably null Het
Syt14 T C 1: 192,986,829 M39V probably benign Het
Tgm7 A G 2: 121,101,064 V206A probably damaging Het
Thbs4 T C 13: 92,760,586 probably null Het
Trpv1 T C 11: 73,254,251 F721S probably damaging Het
Ttll10 A T 4: 156,036,234 M433K probably benign Het
Vmn1r216 T C 13: 23,099,525 I126T probably benign Het
Vmn2r108 G A 17: 20,470,088 S494F probably benign Het
Vwa3b C T 1: 37,128,939 A603V probably benign Het
Xirp2 T A 2: 67,476,866 N19K probably damaging Het
Zfp397 T A 18: 23,960,722 N421K probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Aktip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Aktip APN 8 91126225 missense probably damaging 1.00
IGL02351:Aktip APN 8 91126892 missense possibly damaging 0.73
IGL02358:Aktip APN 8 91126892 missense possibly damaging 0.73
IGL03085:Aktip APN 8 91126023 critical splice donor site probably null
R1564:Aktip UTSW 8 91131081 start codon destroyed probably null 0.94
R1809:Aktip UTSW 8 91129720 missense probably damaging 1.00
R1851:Aktip UTSW 8 91125877 missense possibly damaging 0.93
R4067:Aktip UTSW 8 91125838 missense possibly damaging 0.87
R4455:Aktip UTSW 8 91124851 missense probably benign 0.00
R5052:Aktip UTSW 8 91129651 missense possibly damaging 0.47
R5330:Aktip UTSW 8 91126724 missense probably damaging 0.98
R6134:Aktip UTSW 8 91129760 missense probably damaging 1.00
R6178:Aktip UTSW 8 91126043 missense probably damaging 0.98
R6984:Aktip UTSW 8 91126718 missense probably damaging 1.00
R7672:Aktip UTSW 8 91129657 missense possibly damaging 0.67
R8386:Aktip UTSW 8 91131046 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTCATCAGGCTTCTTCTGGG -3'
(R):5'- GCTCTTTAGCCAGGGATATGGG -3'

Sequencing Primer
(F):5'- AGGCTTCTTCTGGGCACAATC -3'
(R):5'- CAGGCCCGCATTTAAGGCTAAG -3'
Posted On2020-07-13