Incidental Mutation 'R8213:Dock6'
ID 636263
Institutional Source Beutler Lab
Gene Symbol Dock6
Ensembl Gene ENSMUSG00000032198
Gene Name dedicator of cytokinesis 6
Synonyms 4931431C02Rik, 2410095B20Rik, C330023D02Rik
MMRRC Submission 067655-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.482) question?
Stock # R8213 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 21711476-21764006 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 21742740 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 785 (V785A)
Ref Sequence ENSEMBL: ENSMUSP00000034728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034728] [ENSMUST00000058777]
AlphaFold Q8VDR9
Predicted Effect possibly damaging
Transcript: ENSMUST00000034728
AA Change: V785A

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034728
Gene: ENSMUSG00000032198
AA Change: V785A

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Pfam:DUF3398 63 155 4.7e-26 PFAM
low complexity region 419 429 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
Pfam:DOCK-C2 542 721 3.4e-46 PFAM
low complexity region 754 770 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 945 965 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
low complexity region 1123 1153 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
Pfam:DHR-2 1554 2080 6.6e-214 PFAM
low complexity region 2093 2107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058777
SMART Domains Protein: ENSMUSP00000058951
Gene: ENSMUSG00000047822

DomainStartEndE-ValueType
low complexity region 171 191 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis (DOCK) family of atypical guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with small GTPases and are components of intracellular signaling networks. The encoded protein is a group C DOCK protein and plays a role in actin cytoskeletal reorganization by activating the Rho GTPases Cdc42 and Rac1. Mutations in this gene are associated with Adams-Oliver syndrome 2. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,791,605 (GRCm39) Y277C probably damaging Het
Acss1 T A 2: 150,461,630 (GRCm39) D651V possibly damaging Het
Aktip G T 8: 91,851,494 (GRCm39) P243H possibly damaging Het
Arl11 T G 14: 61,548,714 (GRCm39) S175A probably benign Het
Aup1 A G 6: 83,031,588 (GRCm39) probably benign Het
Avil A T 10: 126,844,190 (GRCm39) I250F probably damaging Het
Btnl6 A T 17: 34,727,857 (GRCm39) probably null Het
Ccdc7b C A 8: 129,904,772 (GRCm39) Q137K probably benign Het
Cdk11b G A 4: 155,724,338 (GRCm39) E319K unknown Het
Chka A C 19: 3,935,882 (GRCm39) E196A probably damaging Het
Depdc5 C T 5: 33,094,981 (GRCm39) R753C probably damaging Het
Dhx57 T A 17: 80,582,585 (GRCm39) D340V possibly damaging Het
Dicer1 A T 12: 104,668,952 (GRCm39) D1243E probably benign Het
Dnajb9 A T 12: 44,253,916 (GRCm39) L164M probably benign Het
Efcab5 T C 11: 77,006,897 (GRCm39) Y909C probably damaging Het
Erp44 A T 4: 48,208,783 (GRCm39) S226T probably benign Het
Fgd6 A T 10: 93,879,914 (GRCm39) D256V probably benign Het
Fhl5 A T 4: 25,207,113 (GRCm39) Y218* probably null Het
Filip1 C A 9: 79,725,374 (GRCm39) A1082S probably benign Het
Heatr5a G A 12: 51,938,226 (GRCm39) T1484M probably damaging Het
Herc1 G T 9: 66,358,170 (GRCm39) R2417L probably damaging Het
Hnrnpr A G 4: 136,044,486 (GRCm39) probably benign Het
Igsf5 A T 16: 96,174,188 (GRCm39) I73F probably damaging Het
Il17ra T C 6: 120,449,995 (GRCm39) V91A probably benign Het
Inpp5f A G 7: 128,281,529 (GRCm39) D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 (GRCm39) K548E probably damaging Het
Kdm5d T A Y: 941,515 (GRCm39) C1239S probably damaging Het
Mamdc4 G A 2: 25,456,368 (GRCm39) T709M probably benign Het
Mybbp1a T A 11: 72,335,547 (GRCm39) Y353N probably damaging Het
Nepn A T 10: 52,267,855 (GRCm39) E40D probably benign Het
Nhsl3 A T 4: 129,115,252 (GRCm39) V1070D possibly damaging Het
Npat G T 9: 53,481,870 (GRCm39) E1193* probably null Het
Nrde2 G A 12: 100,097,262 (GRCm39) S846L probably benign Het
Nup205 T C 6: 35,202,138 (GRCm39) V1290A probably benign Het
Or10a49 C A 7: 108,467,726 (GRCm39) V212L probably benign Het
Or4d10b A G 19: 12,036,456 (GRCm39) V220A probably benign Het
Or5g9 T A 2: 85,551,845 (GRCm39) L32Q probably null Het
Pde6a A T 18: 61,353,768 (GRCm39) K31M possibly damaging Het
Pms2 C T 5: 143,851,589 (GRCm39) R169C probably damaging Het
Polr2g A T 19: 8,775,621 (GRCm39) L30Q probably damaging Het
Pramel22 T A 4: 143,380,755 (GRCm39) M423L probably benign Het
Pramel30 A T 4: 144,057,030 (GRCm39) D71V probably benign Het
Prdm15 T A 16: 97,608,260 (GRCm39) H679L probably damaging Het
Prl4a1 T G 13: 28,207,369 (GRCm39) Y214* probably null Het
Prlr C T 15: 10,329,328 (GRCm39) T601M possibly damaging Het
Psen2 A C 1: 180,073,256 (GRCm39) S22A probably benign Het
Ralgapa1 C A 12: 55,769,699 (GRCm39) R764L probably damaging Het
Scgb2b11 T C 7: 31,908,833 (GRCm39) E89G probably damaging Het
Serpina10 T C 12: 103,594,536 (GRCm39) I228V probably benign Het
Serpinb1a T A 13: 33,026,982 (GRCm39) H320L probably damaging Het
Sesn2 C A 4: 132,225,364 (GRCm39) Q267H possibly damaging Het
Sgsm1 A T 5: 113,398,877 (GRCm39) W1019R probably damaging Het
Sqle A G 15: 59,193,151 (GRCm39) probably null Het
Syt14 T C 1: 192,669,137 (GRCm39) M39V probably benign Het
Tgm7 A G 2: 120,931,545 (GRCm39) V206A probably damaging Het
Thbs4 T C 13: 92,897,094 (GRCm39) probably null Het
Trpv1 T C 11: 73,145,077 (GRCm39) F721S probably damaging Het
Ttll10 A T 4: 156,120,691 (GRCm39) M433K probably benign Het
Vmn1r216 T C 13: 23,283,695 (GRCm39) I126T probably benign Het
Vmn2r108 G A 17: 20,690,350 (GRCm39) S494F probably benign Het
Vwa3b C T 1: 37,168,020 (GRCm39) A603V probably benign Het
Xirp2 T A 2: 67,307,210 (GRCm39) N19K probably damaging Het
Zfp397 T A 18: 24,093,779 (GRCm39) N421K probably damaging Het
Zscan5b C T 7: 6,236,946 (GRCm39) P232S possibly damaging Het
Other mutations in Dock6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Dock6 APN 9 21,757,930 (GRCm39) missense possibly damaging 0.50
IGL01025:Dock6 APN 9 21,723,103 (GRCm39) missense possibly damaging 0.89
IGL01390:Dock6 APN 9 21,714,341 (GRCm39) missense probably damaging 1.00
IGL02025:Dock6 APN 9 21,720,885 (GRCm39) missense probably damaging 0.98
IGL02028:Dock6 APN 9 21,750,122 (GRCm39) missense probably damaging 1.00
IGL02311:Dock6 APN 9 21,755,624 (GRCm39) missense probably damaging 1.00
IGL02441:Dock6 APN 9 21,753,222 (GRCm39) missense possibly damaging 0.77
IGL02504:Dock6 APN 9 21,757,951 (GRCm39) missense probably benign 0.19
IGL02516:Dock6 APN 9 21,713,881 (GRCm39) missense probably damaging 1.00
IGL02836:Dock6 APN 9 21,713,160 (GRCm39) missense probably damaging 1.00
IGL02894:Dock6 APN 9 21,723,111 (GRCm39) missense probably damaging 1.00
backwater UTSW 9 21,735,712 (GRCm39) missense probably benign 0.29
bayfront UTSW 9 21,733,041 (GRCm39) missense probably benign 0.29
marshland UTSW 9 21,752,899 (GRCm39) missense probably benign 0.00
Shallows UTSW 9 21,731,918 (GRCm39) missense probably benign
IGL03048:Dock6 UTSW 9 21,720,866 (GRCm39) missense probably damaging 1.00
R0370:Dock6 UTSW 9 21,725,861 (GRCm39) missense probably benign 0.29
R0504:Dock6 UTSW 9 21,713,732 (GRCm39) missense probably damaging 1.00
R0633:Dock6 UTSW 9 21,755,713 (GRCm39) missense probably benign 0.00
R0634:Dock6 UTSW 9 21,752,823 (GRCm39) missense probably damaging 1.00
R0671:Dock6 UTSW 9 21,715,923 (GRCm39) splice site probably benign
R0839:Dock6 UTSW 9 21,729,188 (GRCm39) missense probably benign 0.01
R0948:Dock6 UTSW 9 21,712,829 (GRCm39) missense probably damaging 1.00
R1022:Dock6 UTSW 9 21,744,908 (GRCm39) missense probably damaging 1.00
R1024:Dock6 UTSW 9 21,744,908 (GRCm39) missense probably damaging 1.00
R1073:Dock6 UTSW 9 21,757,814 (GRCm39) missense probably benign
R1463:Dock6 UTSW 9 21,743,202 (GRCm39) missense probably damaging 1.00
R1481:Dock6 UTSW 9 21,731,918 (GRCm39) missense probably benign
R1494:Dock6 UTSW 9 21,726,038 (GRCm39) missense probably benign 0.34
R1547:Dock6 UTSW 9 21,725,884 (GRCm39) missense probably damaging 1.00
R1654:Dock6 UTSW 9 21,716,139 (GRCm39) missense probably damaging 0.98
R1782:Dock6 UTSW 9 21,723,142 (GRCm39) missense probably damaging 1.00
R1905:Dock6 UTSW 9 21,740,870 (GRCm39) missense probably benign 0.37
R1908:Dock6 UTSW 9 21,752,925 (GRCm39) missense probably damaging 1.00
R1916:Dock6 UTSW 9 21,724,387 (GRCm39) missense probably damaging 1.00
R2132:Dock6 UTSW 9 21,757,814 (GRCm39) missense probably benign
R2197:Dock6 UTSW 9 21,744,177 (GRCm39) missense probably damaging 1.00
R2316:Dock6 UTSW 9 21,750,973 (GRCm39) missense probably damaging 0.98
R2341:Dock6 UTSW 9 21,750,782 (GRCm39) splice site probably benign
R2519:Dock6 UTSW 9 21,727,629 (GRCm39) missense possibly damaging 0.54
R2924:Dock6 UTSW 9 21,720,926 (GRCm39) missense probably damaging 1.00
R2939:Dock6 UTSW 9 21,750,496 (GRCm39) missense possibly damaging 0.88
R2940:Dock6 UTSW 9 21,750,496 (GRCm39) missense possibly damaging 0.88
R3078:Dock6 UTSW 9 21,757,050 (GRCm39) splice site probably benign
R3081:Dock6 UTSW 9 21,750,496 (GRCm39) missense possibly damaging 0.88
R3810:Dock6 UTSW 9 21,712,873 (GRCm39) missense probably damaging 1.00
R4246:Dock6 UTSW 9 21,750,786 (GRCm39) splice site probably null
R4604:Dock6 UTSW 9 21,713,836 (GRCm39) missense probably damaging 1.00
R4833:Dock6 UTSW 9 21,755,576 (GRCm39) missense probably damaging 1.00
R4849:Dock6 UTSW 9 21,723,068 (GRCm39) critical splice donor site probably null
R4896:Dock6 UTSW 9 21,735,733 (GRCm39) missense possibly damaging 0.48
R4926:Dock6 UTSW 9 21,757,087 (GRCm39) missense probably damaging 1.00
R5183:Dock6 UTSW 9 21,752,899 (GRCm39) missense probably benign 0.00
R5211:Dock6 UTSW 9 21,731,648 (GRCm39) missense probably benign 0.36
R5337:Dock6 UTSW 9 21,740,844 (GRCm39) missense possibly damaging 0.93
R5353:Dock6 UTSW 9 21,726,082 (GRCm39) missense probably benign 0.00
R5429:Dock6 UTSW 9 21,744,177 (GRCm39) missense probably damaging 0.99
R5463:Dock6 UTSW 9 21,721,254 (GRCm39) splice site probably null
R5476:Dock6 UTSW 9 21,720,885 (GRCm39) missense probably damaging 0.98
R5511:Dock6 UTSW 9 21,728,703 (GRCm39) missense possibly damaging 0.59
R5534:Dock6 UTSW 9 21,714,372 (GRCm39) nonsense probably null
R5718:Dock6 UTSW 9 21,735,789 (GRCm39) missense probably benign 0.11
R5823:Dock6 UTSW 9 21,716,124 (GRCm39) missense probably damaging 0.99
R5831:Dock6 UTSW 9 21,714,332 (GRCm39) missense probably damaging 1.00
R5887:Dock6 UTSW 9 21,731,690 (GRCm39) missense probably damaging 0.96
R5930:Dock6 UTSW 9 21,735,712 (GRCm39) missense probably benign 0.29
R6159:Dock6 UTSW 9 21,733,041 (GRCm39) missense probably benign 0.29
R6633:Dock6 UTSW 9 21,732,799 (GRCm39) missense probably damaging 1.00
R6633:Dock6 UTSW 9 21,731,627 (GRCm39) missense probably benign 0.17
R6665:Dock6 UTSW 9 21,751,208 (GRCm39) missense probably damaging 0.99
R6744:Dock6 UTSW 9 21,742,770 (GRCm39) missense probably damaging 1.00
R6903:Dock6 UTSW 9 21,720,860 (GRCm39) missense probably damaging 1.00
R6981:Dock6 UTSW 9 21,756,846 (GRCm39) missense probably damaging 0.99
R7024:Dock6 UTSW 9 21,731,666 (GRCm39) missense probably benign
R7030:Dock6 UTSW 9 21,724,375 (GRCm39) missense probably damaging 1.00
R7045:Dock6 UTSW 9 21,733,107 (GRCm39) missense probably damaging 1.00
R7139:Dock6 UTSW 9 21,712,572 (GRCm39) missense probably damaging 1.00
R7356:Dock6 UTSW 9 21,721,195 (GRCm39) missense probably damaging 1.00
R7400:Dock6 UTSW 9 21,713,103 (GRCm39) missense possibly damaging 0.62
R7847:Dock6 UTSW 9 21,712,503 (GRCm39) missense unknown
R7863:Dock6 UTSW 9 21,757,954 (GRCm39) missense possibly damaging 0.85
R7991:Dock6 UTSW 9 21,757,858 (GRCm39) missense probably damaging 1.00
R7992:Dock6 UTSW 9 21,744,135 (GRCm39) critical splice donor site probably null
R8012:Dock6 UTSW 9 21,757,807 (GRCm39) missense probably benign 0.16
R8184:Dock6 UTSW 9 21,741,596 (GRCm39) missense possibly damaging 0.54
R8560:Dock6 UTSW 9 21,714,132 (GRCm39) missense probably benign 0.00
R8828:Dock6 UTSW 9 21,757,797 (GRCm39) missense probably benign
R9090:Dock6 UTSW 9 21,752,796 (GRCm39) missense possibly damaging 0.75
R9221:Dock6 UTSW 9 21,721,153 (GRCm39) missense possibly damaging 0.77
R9271:Dock6 UTSW 9 21,752,796 (GRCm39) missense possibly damaging 0.75
R9301:Dock6 UTSW 9 21,729,111 (GRCm39) missense probably benign
R9308:Dock6 UTSW 9 21,728,744 (GRCm39) nonsense probably null
R9476:Dock6 UTSW 9 21,724,821 (GRCm39) missense probably damaging 1.00
R9526:Dock6 UTSW 9 21,713,802 (GRCm39) nonsense probably null
R9544:Dock6 UTSW 9 21,732,830 (GRCm39) nonsense probably null
R9716:Dock6 UTSW 9 21,742,418 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCAAGTTCCACAGCCCAAG -3'
(R):5'- CTGGTACATGTTCTAGAGGAAGGG -3'

Sequencing Primer
(F):5'- CCCATTCATTTTCCAGAGGAGGG -3'
(R):5'- AAGGGATCTTTCCGTTCCGAC -3'
Posted On 2020-07-13