Incidental Mutation 'R8213:Npat'
ID 636264
Institutional Source Beutler Lab
Gene Symbol Npat
Ensembl Gene ENSMUSG00000033054
Gene Name nuclear protein in the AT region
Synonyms
MMRRC Submission 067655-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8213 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 53448347-53485642 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 53481870 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1193 (E1193*)
Ref Sequence ENSEMBL: ENSMUSP00000048709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035850]
AlphaFold Q8BMA5
Predicted Effect probably null
Transcript: ENSMUST00000035850
AA Change: E1193*
SMART Domains Protein: ENSMUSP00000048709
Gene: ENSMUSG00000033054
AA Change: E1193*

DomainStartEndE-ValueType
LisH 3 35 3.09e-3 SMART
low complexity region 585 592 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
Pfam:NPAT_C 754 1420 4.7e-299 PFAM
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,791,605 (GRCm39) Y277C probably damaging Het
Acss1 T A 2: 150,461,630 (GRCm39) D651V possibly damaging Het
Aktip G T 8: 91,851,494 (GRCm39) P243H possibly damaging Het
Arl11 T G 14: 61,548,714 (GRCm39) S175A probably benign Het
Aup1 A G 6: 83,031,588 (GRCm39) probably benign Het
Avil A T 10: 126,844,190 (GRCm39) I250F probably damaging Het
Btnl6 A T 17: 34,727,857 (GRCm39) probably null Het
Ccdc7b C A 8: 129,904,772 (GRCm39) Q137K probably benign Het
Cdk11b G A 4: 155,724,338 (GRCm39) E319K unknown Het
Chka A C 19: 3,935,882 (GRCm39) E196A probably damaging Het
Depdc5 C T 5: 33,094,981 (GRCm39) R753C probably damaging Het
Dhx57 T A 17: 80,582,585 (GRCm39) D340V possibly damaging Het
Dicer1 A T 12: 104,668,952 (GRCm39) D1243E probably benign Het
Dnajb9 A T 12: 44,253,916 (GRCm39) L164M probably benign Het
Dock6 A G 9: 21,742,740 (GRCm39) V785A possibly damaging Het
Efcab5 T C 11: 77,006,897 (GRCm39) Y909C probably damaging Het
Erp44 A T 4: 48,208,783 (GRCm39) S226T probably benign Het
Fgd6 A T 10: 93,879,914 (GRCm39) D256V probably benign Het
Fhl5 A T 4: 25,207,113 (GRCm39) Y218* probably null Het
Filip1 C A 9: 79,725,374 (GRCm39) A1082S probably benign Het
Heatr5a G A 12: 51,938,226 (GRCm39) T1484M probably damaging Het
Herc1 G T 9: 66,358,170 (GRCm39) R2417L probably damaging Het
Hnrnpr A G 4: 136,044,486 (GRCm39) probably benign Het
Igsf5 A T 16: 96,174,188 (GRCm39) I73F probably damaging Het
Il17ra T C 6: 120,449,995 (GRCm39) V91A probably benign Het
Inpp5f A G 7: 128,281,529 (GRCm39) D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 (GRCm39) K548E probably damaging Het
Kdm5d T A Y: 941,515 (GRCm39) C1239S probably damaging Het
Mamdc4 G A 2: 25,456,368 (GRCm39) T709M probably benign Het
Mybbp1a T A 11: 72,335,547 (GRCm39) Y353N probably damaging Het
Nepn A T 10: 52,267,855 (GRCm39) E40D probably benign Het
Nhsl3 A T 4: 129,115,252 (GRCm39) V1070D possibly damaging Het
Nrde2 G A 12: 100,097,262 (GRCm39) S846L probably benign Het
Nup205 T C 6: 35,202,138 (GRCm39) V1290A probably benign Het
Or10a49 C A 7: 108,467,726 (GRCm39) V212L probably benign Het
Or4d10b A G 19: 12,036,456 (GRCm39) V220A probably benign Het
Or5g9 T A 2: 85,551,845 (GRCm39) L32Q probably null Het
Pde6a A T 18: 61,353,768 (GRCm39) K31M possibly damaging Het
Pms2 C T 5: 143,851,589 (GRCm39) R169C probably damaging Het
Polr2g A T 19: 8,775,621 (GRCm39) L30Q probably damaging Het
Pramel22 T A 4: 143,380,755 (GRCm39) M423L probably benign Het
Pramel30 A T 4: 144,057,030 (GRCm39) D71V probably benign Het
Prdm15 T A 16: 97,608,260 (GRCm39) H679L probably damaging Het
Prl4a1 T G 13: 28,207,369 (GRCm39) Y214* probably null Het
Prlr C T 15: 10,329,328 (GRCm39) T601M possibly damaging Het
Psen2 A C 1: 180,073,256 (GRCm39) S22A probably benign Het
Ralgapa1 C A 12: 55,769,699 (GRCm39) R764L probably damaging Het
Scgb2b11 T C 7: 31,908,833 (GRCm39) E89G probably damaging Het
Serpina10 T C 12: 103,594,536 (GRCm39) I228V probably benign Het
Serpinb1a T A 13: 33,026,982 (GRCm39) H320L probably damaging Het
Sesn2 C A 4: 132,225,364 (GRCm39) Q267H possibly damaging Het
Sgsm1 A T 5: 113,398,877 (GRCm39) W1019R probably damaging Het
Sqle A G 15: 59,193,151 (GRCm39) probably null Het
Syt14 T C 1: 192,669,137 (GRCm39) M39V probably benign Het
Tgm7 A G 2: 120,931,545 (GRCm39) V206A probably damaging Het
Thbs4 T C 13: 92,897,094 (GRCm39) probably null Het
Trpv1 T C 11: 73,145,077 (GRCm39) F721S probably damaging Het
Ttll10 A T 4: 156,120,691 (GRCm39) M433K probably benign Het
Vmn1r216 T C 13: 23,283,695 (GRCm39) I126T probably benign Het
Vmn2r108 G A 17: 20,690,350 (GRCm39) S494F probably benign Het
Vwa3b C T 1: 37,168,020 (GRCm39) A603V probably benign Het
Xirp2 T A 2: 67,307,210 (GRCm39) N19K probably damaging Het
Zfp397 T A 18: 24,093,779 (GRCm39) N421K probably damaging Het
Zscan5b C T 7: 6,236,946 (GRCm39) P232S possibly damaging Het
Other mutations in Npat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Npat APN 9 53,478,100 (GRCm39) missense possibly damaging 0.82
IGL00503:Npat APN 9 53,483,949 (GRCm39) utr 3 prime probably benign
IGL00694:Npat APN 9 53,474,817 (GRCm39) missense probably benign 0.00
IGL00731:Npat APN 9 53,473,386 (GRCm39) missense probably damaging 0.99
IGL00907:Npat APN 9 53,474,590 (GRCm39) missense possibly damaging 0.64
IGL00949:Npat APN 9 53,474,662 (GRCm39) missense probably benign 0.17
IGL01403:Npat APN 9 53,466,429 (GRCm39) missense probably benign 0.02
IGL01626:Npat APN 9 53,467,871 (GRCm39) missense possibly damaging 0.92
IGL01936:Npat APN 9 53,469,526 (GRCm39) splice site probably benign
IGL02142:Npat APN 9 53,481,207 (GRCm39) missense probably benign
IGL02215:Npat APN 9 53,470,417 (GRCm39) missense probably benign 0.00
IGL02250:Npat APN 9 53,460,251 (GRCm39) nonsense probably null
IGL02624:Npat APN 9 53,478,110 (GRCm39) missense probably damaging 1.00
IGL02928:Npat APN 9 53,478,138 (GRCm39) splice site probably benign
IGL02931:Npat APN 9 53,482,341 (GRCm39) nonsense probably null
IGL03128:Npat APN 9 53,461,333 (GRCm39) splice site probably benign
IGL03238:Npat APN 9 53,481,726 (GRCm39) missense probably damaging 0.98
Flotsam UTSW 9 53,481,870 (GRCm39) nonsense probably null
kindling UTSW 9 53,474,749 (GRCm39) missense probably damaging 0.99
R0606:Npat UTSW 9 53,467,781 (GRCm39) critical splice donor site probably null
R0688:Npat UTSW 9 53,481,522 (GRCm39) missense probably benign 0.18
R0839:Npat UTSW 9 53,456,480 (GRCm39) missense probably damaging 0.99
R0947:Npat UTSW 9 53,481,624 (GRCm39) missense probably benign 0.08
R1070:Npat UTSW 9 53,483,892 (GRCm39) missense probably damaging 1.00
R1480:Npat UTSW 9 53,474,366 (GRCm39) frame shift probably null
R1599:Npat UTSW 9 53,473,704 (GRCm39) missense possibly damaging 0.62
R1644:Npat UTSW 9 53,481,472 (GRCm39) missense probably damaging 1.00
R1646:Npat UTSW 9 53,466,434 (GRCm39) missense probably benign 0.32
R1699:Npat UTSW 9 53,473,960 (GRCm39) missense probably benign
R1765:Npat UTSW 9 53,481,522 (GRCm39) missense probably benign 0.00
R1793:Npat UTSW 9 53,463,589 (GRCm39) missense probably damaging 1.00
R1866:Npat UTSW 9 53,474,416 (GRCm39) missense probably damaging 1.00
R1898:Npat UTSW 9 53,474,937 (GRCm39) missense probably damaging 1.00
R2018:Npat UTSW 9 53,473,791 (GRCm39) missense probably benign 0.34
R2019:Npat UTSW 9 53,473,791 (GRCm39) missense probably benign 0.34
R2213:Npat UTSW 9 53,463,681 (GRCm39) missense probably benign 0.00
R2432:Npat UTSW 9 53,469,435 (GRCm39) missense probably damaging 1.00
R3816:Npat UTSW 9 53,481,216 (GRCm39) missense probably damaging 0.99
R4764:Npat UTSW 9 53,483,920 (GRCm39) missense probably damaging 1.00
R4889:Npat UTSW 9 53,473,507 (GRCm39) missense probably benign 0.00
R4895:Npat UTSW 9 53,481,789 (GRCm39) missense probably damaging 1.00
R4923:Npat UTSW 9 53,482,330 (GRCm39) missense probably damaging 1.00
R5377:Npat UTSW 9 53,461,336 (GRCm39) critical splice acceptor site probably null
R5397:Npat UTSW 9 53,481,774 (GRCm39) missense probably damaging 1.00
R5504:Npat UTSW 9 53,481,564 (GRCm39) missense probably benign 0.01
R5509:Npat UTSW 9 53,481,542 (GRCm39) missense probably benign 0.00
R5563:Npat UTSW 9 53,474,427 (GRCm39) missense probably damaging 0.97
R5677:Npat UTSW 9 53,466,400 (GRCm39) missense probably benign 0.00
R5868:Npat UTSW 9 53,481,424 (GRCm39) missense probably damaging 0.96
R5927:Npat UTSW 9 53,473,521 (GRCm39) nonsense probably null
R6009:Npat UTSW 9 53,474,749 (GRCm39) missense probably damaging 0.99
R6247:Npat UTSW 9 53,456,538 (GRCm39) missense probably damaging 1.00
R6434:Npat UTSW 9 53,474,739 (GRCm39) missense possibly damaging 0.81
R6784:Npat UTSW 9 53,469,458 (GRCm39) missense probably damaging 1.00
R6799:Npat UTSW 9 53,462,930 (GRCm39) missense probably benign 0.21
R6878:Npat UTSW 9 53,467,899 (GRCm39) missense probably benign
R7027:Npat UTSW 9 53,481,216 (GRCm39) missense possibly damaging 0.90
R7383:Npat UTSW 9 53,474,078 (GRCm39) missense probably benign
R7404:Npat UTSW 9 53,466,233 (GRCm39) splice site probably null
R7408:Npat UTSW 9 53,481,216 (GRCm39) missense probably damaging 0.99
R7444:Npat UTSW 9 53,460,210 (GRCm39) missense probably damaging 0.97
R7755:Npat UTSW 9 53,470,470 (GRCm39) missense possibly damaging 0.92
R7992:Npat UTSW 9 53,474,167 (GRCm39) missense probably benign 0.00
R8108:Npat UTSW 9 53,482,429 (GRCm39) missense probably benign 0.00
R8126:Npat UTSW 9 53,463,634 (GRCm39) missense probably benign
R8354:Npat UTSW 9 53,478,251 (GRCm39) missense possibly damaging 0.93
R8429:Npat UTSW 9 53,481,909 (GRCm39) nonsense probably null
R8454:Npat UTSW 9 53,478,251 (GRCm39) missense possibly damaging 0.93
R8865:Npat UTSW 9 53,481,940 (GRCm39) missense probably benign 0.00
R8894:Npat UTSW 9 53,467,951 (GRCm39) missense probably damaging 1.00
R9045:Npat UTSW 9 53,474,776 (GRCm39) missense possibly damaging 0.83
R9375:Npat UTSW 9 53,474,456 (GRCm39) missense possibly damaging 0.69
R9511:Npat UTSW 9 53,473,406 (GRCm39) missense probably benign 0.02
R9723:Npat UTSW 9 53,481,861 (GRCm39) missense probably damaging 1.00
R9723:Npat UTSW 9 53,473,746 (GRCm39) missense probably benign 0.01
Z1177:Npat UTSW 9 53,478,128 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AAACTGCCTCTAGTCGACAC -3'
(R):5'- TGGCAAGTCAGTATCGGCAC -3'

Sequencing Primer
(F):5'- GCCTCTAGTCGACACACCACTG -3'
(R):5'- AAGTCAGTATCGGCACTCCTATTGG -3'
Posted On 2020-07-13