Incidental Mutation 'R8213:Trpv1'
ID 636271
Institutional Source Beutler Lab
Gene Symbol Trpv1
Ensembl Gene ENSMUSG00000005952
Gene Name transient receptor potential cation channel, subfamily V, member 1
Synonyms VR-1, capsaicin receptor, Vr1, OTRPC1
MMRRC Submission 067655-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.331) question?
Stock # R8213 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 73125118-73152068 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73145077 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 721 (F721S)
Ref Sequence ENSEMBL: ENSMUSP00000099585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006106] [ENSMUST00000102526] [ENSMUST00000108470] [ENSMUST00000138853]
AlphaFold Q704Y3
Predicted Effect probably damaging
Transcript: ENSMUST00000006106
AA Change: F661S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006106
Gene: ENSMUSG00000005952
AA Change: F661S

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
ANK 154 186 1.6e2 SMART
ANK 201 230 5.62e-4 SMART
ANK 248 277 2.3e0 SMART
Blast:ANK 285 321 4e-8 BLAST
Blast:ANK 334 370 6e-9 BLAST
PDB:3J5R|D 339 660 N/A PDB
Blast:PHB 658 704 1e-8 BLAST
PDB:3SUI|B 708 742 1e-15 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000102526
AA Change: F721S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099585
Gene: ENSMUSG00000005952
AA Change: F721S

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
ANK 154 186 1.6e2 SMART
ANK 201 230 5.62e-4 SMART
ANK 248 277 2.3e0 SMART
Blast:ANK 285 321 5e-8 BLAST
ANK 333 363 6.17e-1 SMART
Pfam:Ion_trans 432 695 3e-12 PFAM
Blast:PHB 718 764 1e-8 BLAST
PDB:3SUI|B 768 802 1e-15 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000108470
AA Change: F353S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104110
Gene: ENSMUSG00000005952
AA Change: F353S

DomainStartEndE-ValueType
Blast:ANK 26 62 4e-9 BLAST
Pfam:Ion_trans 111 315 1.8e-8 PFAM
Blast:PHB 350 396 6e-9 BLAST
PDB:3SUI|B 400 434 1e-15 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000138853
AA Change: F413S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116400
Gene: ENSMUSG00000005952
AA Change: F413S

DomainStartEndE-ValueType
ANK 25 55 6.17e-1 SMART
Pfam:Ion_trans 171 375 1.8e-8 PFAM
Blast:PHB 410 456 6e-9 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Capsaicin, the main pungent ingredient in hot chili peppers, elicits a sensation of burning pain by selectively activating sensory neurons that convey information about noxious stimuli to the central nervous system. The protein encoded by this gene is a receptor for capsaicin and is a non-selective cation channel that is structurally related to members of the TRP family of ion channels. This receptor is also activated by increases in temperature in the noxious range, suggesting that it functions as a transducer of painful thermal stimuli in vivo. Four transcript variants encoding the same protein, but with different 5' UTR sequence, have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice demonstrate abnormal nociception, abnormal anxiety- and conditioning-related behaviors, increased sensitivity to DOCA-salt-induced renal damage, resistance to diet-induced obesity, altered taste sensitivity, and impaired febrile response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,791,605 (GRCm39) Y277C probably damaging Het
Acss1 T A 2: 150,461,630 (GRCm39) D651V possibly damaging Het
Aktip G T 8: 91,851,494 (GRCm39) P243H possibly damaging Het
Arl11 T G 14: 61,548,714 (GRCm39) S175A probably benign Het
Aup1 A G 6: 83,031,588 (GRCm39) probably benign Het
Avil A T 10: 126,844,190 (GRCm39) I250F probably damaging Het
Btnl6 A T 17: 34,727,857 (GRCm39) probably null Het
Ccdc7b C A 8: 129,904,772 (GRCm39) Q137K probably benign Het
Cdk11b G A 4: 155,724,338 (GRCm39) E319K unknown Het
Chka A C 19: 3,935,882 (GRCm39) E196A probably damaging Het
Depdc5 C T 5: 33,094,981 (GRCm39) R753C probably damaging Het
Dhx57 T A 17: 80,582,585 (GRCm39) D340V possibly damaging Het
Dicer1 A T 12: 104,668,952 (GRCm39) D1243E probably benign Het
Dnajb9 A T 12: 44,253,916 (GRCm39) L164M probably benign Het
Dock6 A G 9: 21,742,740 (GRCm39) V785A possibly damaging Het
Efcab5 T C 11: 77,006,897 (GRCm39) Y909C probably damaging Het
Erp44 A T 4: 48,208,783 (GRCm39) S226T probably benign Het
Fgd6 A T 10: 93,879,914 (GRCm39) D256V probably benign Het
Fhl5 A T 4: 25,207,113 (GRCm39) Y218* probably null Het
Filip1 C A 9: 79,725,374 (GRCm39) A1082S probably benign Het
Heatr5a G A 12: 51,938,226 (GRCm39) T1484M probably damaging Het
Herc1 G T 9: 66,358,170 (GRCm39) R2417L probably damaging Het
Hnrnpr A G 4: 136,044,486 (GRCm39) probably benign Het
Igsf5 A T 16: 96,174,188 (GRCm39) I73F probably damaging Het
Il17ra T C 6: 120,449,995 (GRCm39) V91A probably benign Het
Inpp5f A G 7: 128,281,529 (GRCm39) D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 (GRCm39) K548E probably damaging Het
Kdm5d T A Y: 941,515 (GRCm39) C1239S probably damaging Het
Mamdc4 G A 2: 25,456,368 (GRCm39) T709M probably benign Het
Mybbp1a T A 11: 72,335,547 (GRCm39) Y353N probably damaging Het
Nepn A T 10: 52,267,855 (GRCm39) E40D probably benign Het
Nhsl3 A T 4: 129,115,252 (GRCm39) V1070D possibly damaging Het
Npat G T 9: 53,481,870 (GRCm39) E1193* probably null Het
Nrde2 G A 12: 100,097,262 (GRCm39) S846L probably benign Het
Nup205 T C 6: 35,202,138 (GRCm39) V1290A probably benign Het
Or10a49 C A 7: 108,467,726 (GRCm39) V212L probably benign Het
Or4d10b A G 19: 12,036,456 (GRCm39) V220A probably benign Het
Or5g9 T A 2: 85,551,845 (GRCm39) L32Q probably null Het
Pde6a A T 18: 61,353,768 (GRCm39) K31M possibly damaging Het
Pms2 C T 5: 143,851,589 (GRCm39) R169C probably damaging Het
Polr2g A T 19: 8,775,621 (GRCm39) L30Q probably damaging Het
Pramel22 T A 4: 143,380,755 (GRCm39) M423L probably benign Het
Pramel30 A T 4: 144,057,030 (GRCm39) D71V probably benign Het
Prdm15 T A 16: 97,608,260 (GRCm39) H679L probably damaging Het
Prl4a1 T G 13: 28,207,369 (GRCm39) Y214* probably null Het
Prlr C T 15: 10,329,328 (GRCm39) T601M possibly damaging Het
Psen2 A C 1: 180,073,256 (GRCm39) S22A probably benign Het
Ralgapa1 C A 12: 55,769,699 (GRCm39) R764L probably damaging Het
Scgb2b11 T C 7: 31,908,833 (GRCm39) E89G probably damaging Het
Serpina10 T C 12: 103,594,536 (GRCm39) I228V probably benign Het
Serpinb1a T A 13: 33,026,982 (GRCm39) H320L probably damaging Het
Sesn2 C A 4: 132,225,364 (GRCm39) Q267H possibly damaging Het
Sgsm1 A T 5: 113,398,877 (GRCm39) W1019R probably damaging Het
Sqle A G 15: 59,193,151 (GRCm39) probably null Het
Syt14 T C 1: 192,669,137 (GRCm39) M39V probably benign Het
Tgm7 A G 2: 120,931,545 (GRCm39) V206A probably damaging Het
Thbs4 T C 13: 92,897,094 (GRCm39) probably null Het
Ttll10 A T 4: 156,120,691 (GRCm39) M433K probably benign Het
Vmn1r216 T C 13: 23,283,695 (GRCm39) I126T probably benign Het
Vmn2r108 G A 17: 20,690,350 (GRCm39) S494F probably benign Het
Vwa3b C T 1: 37,168,020 (GRCm39) A603V probably benign Het
Xirp2 T A 2: 67,307,210 (GRCm39) N19K probably damaging Het
Zfp397 T A 18: 24,093,779 (GRCm39) N421K probably damaging Het
Zscan5b C T 7: 6,236,946 (GRCm39) P232S possibly damaging Het
Other mutations in Trpv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Trpv1 APN 11 73,151,188 (GRCm39) missense probably damaging 0.99
IGL01348:Trpv1 APN 11 73,129,078 (GRCm39) splice site probably null
IGL01568:Trpv1 APN 11 73,129,269 (GRCm39) missense probably benign 0.01
IGL01638:Trpv1 APN 11 73,144,155 (GRCm39) missense probably damaging 0.98
IGL02092:Trpv1 APN 11 73,136,905 (GRCm39) splice site probably benign
IGL02167:Trpv1 APN 11 73,145,623 (GRCm39) missense probably damaging 1.00
IGL02649:Trpv1 APN 11 73,141,612 (GRCm39) missense probably damaging 1.00
IGL03396:Trpv1 APN 11 73,143,882 (GRCm39) missense probably benign 0.01
IGL03402:Trpv1 APN 11 73,130,463 (GRCm39) missense possibly damaging 0.73
R0112:Trpv1 UTSW 11 73,144,098 (GRCm39) missense probably damaging 1.00
R0433:Trpv1 UTSW 11 73,143,834 (GRCm39) splice site probably benign
R0482:Trpv1 UTSW 11 73,130,255 (GRCm39) missense probably damaging 1.00
R0494:Trpv1 UTSW 11 73,151,268 (GRCm39) missense probably benign
R1401:Trpv1 UTSW 11 73,130,952 (GRCm39) splice site probably null
R2032:Trpv1 UTSW 11 73,129,211 (GRCm39) missense probably benign
R2199:Trpv1 UTSW 11 73,131,077 (GRCm39) missense probably damaging 0.96
R2263:Trpv1 UTSW 11 73,132,508 (GRCm39) missense probably damaging 1.00
R2939:Trpv1 UTSW 11 73,145,675 (GRCm39) missense probably damaging 0.99
R2940:Trpv1 UTSW 11 73,145,675 (GRCm39) missense probably damaging 0.99
R3743:Trpv1 UTSW 11 73,145,128 (GRCm39) missense probably damaging 1.00
R3805:Trpv1 UTSW 11 73,143,879 (GRCm39) missense probably damaging 0.99
R4073:Trpv1 UTSW 11 73,141,606 (GRCm39) missense probably damaging 0.96
R4294:Trpv1 UTSW 11 73,131,290 (GRCm39) missense probably damaging 1.00
R4650:Trpv1 UTSW 11 73,129,089 (GRCm39) missense probably benign 0.04
R4700:Trpv1 UTSW 11 73,142,110 (GRCm39) missense possibly damaging 0.47
R5114:Trpv1 UTSW 11 73,132,574 (GRCm39) missense probably damaging 1.00
R5153:Trpv1 UTSW 11 73,129,342 (GRCm39) missense probably benign 0.32
R5319:Trpv1 UTSW 11 73,130,415 (GRCm39) missense probably damaging 0.99
R5516:Trpv1 UTSW 11 73,136,809 (GRCm39) missense probably benign 0.44
R5845:Trpv1 UTSW 11 73,131,407 (GRCm39) missense probably damaging 1.00
R6134:Trpv1 UTSW 11 73,135,143 (GRCm39) missense probably benign 0.01
R6232:Trpv1 UTSW 11 73,141,636 (GRCm39) missense possibly damaging 0.88
R6383:Trpv1 UTSW 11 73,136,862 (GRCm39) missense probably damaging 1.00
R7200:Trpv1 UTSW 11 73,130,412 (GRCm39) missense probably damaging 1.00
R7319:Trpv1 UTSW 11 73,141,620 (GRCm39) missense probably benign 0.01
R7323:Trpv1 UTSW 11 73,151,163 (GRCm39) missense possibly damaging 0.82
R7361:Trpv1 UTSW 11 73,151,203 (GRCm39) missense probably damaging 0.99
R7373:Trpv1 UTSW 11 73,131,499 (GRCm39) missense probably damaging 1.00
R7444:Trpv1 UTSW 11 73,135,030 (GRCm39) missense possibly damaging 0.89
R7488:Trpv1 UTSW 11 73,129,355 (GRCm39) missense probably benign 0.00
R7513:Trpv1 UTSW 11 73,131,367 (GRCm39) missense probably damaging 1.00
R7762:Trpv1 UTSW 11 73,145,048 (GRCm39) missense probably benign 0.01
R7991:Trpv1 UTSW 11 73,132,583 (GRCm39) missense possibly damaging 0.93
R8261:Trpv1 UTSW 11 73,145,593 (GRCm39) critical splice acceptor site probably null
R8753:Trpv1 UTSW 11 73,135,082 (GRCm39) missense probably damaging 1.00
R9176:Trpv1 UTSW 11 73,130,481 (GRCm39) missense probably benign 0.37
R9183:Trpv1 UTSW 11 73,135,039 (GRCm39) missense possibly damaging 0.87
R9190:Trpv1 UTSW 11 73,145,148 (GRCm39) critical splice donor site probably null
R9222:Trpv1 UTSW 11 73,141,681 (GRCm39) missense possibly damaging 0.87
R9241:Trpv1 UTSW 11 73,151,182 (GRCm39) missense probably benign 0.01
R9508:Trpv1 UTSW 11 73,145,090 (GRCm39) missense
R9727:Trpv1 UTSW 11 73,130,347 (GRCm39) missense probably damaging 1.00
X0067:Trpv1 UTSW 11 73,135,027 (GRCm39) critical splice acceptor site probably null
Z1176:Trpv1 UTSW 11 73,131,333 (GRCm39) missense probably damaging 1.00
Z1176:Trpv1 UTSW 11 73,131,014 (GRCm39) missense probably damaging 1.00
Z1177:Trpv1 UTSW 11 73,145,599 (GRCm39) missense probably damaging 1.00
Z1186:Trpv1 UTSW 11 73,145,117 (GRCm39) missense probably benign 0.12
Z1186:Trpv1 UTSW 11 73,131,427 (GRCm39) missense possibly damaging 0.90
Z1187:Trpv1 UTSW 11 73,145,117 (GRCm39) missense probably benign 0.12
Z1187:Trpv1 UTSW 11 73,131,427 (GRCm39) missense possibly damaging 0.90
Z1188:Trpv1 UTSW 11 73,145,117 (GRCm39) missense probably benign 0.12
Z1188:Trpv1 UTSW 11 73,131,427 (GRCm39) missense possibly damaging 0.90
Z1189:Trpv1 UTSW 11 73,145,117 (GRCm39) missense probably benign 0.12
Z1189:Trpv1 UTSW 11 73,131,427 (GRCm39) missense possibly damaging 0.90
Z1190:Trpv1 UTSW 11 73,145,117 (GRCm39) missense probably benign 0.12
Z1190:Trpv1 UTSW 11 73,131,427 (GRCm39) missense possibly damaging 0.90
Z1191:Trpv1 UTSW 11 73,145,117 (GRCm39) missense probably benign 0.12
Z1191:Trpv1 UTSW 11 73,131,427 (GRCm39) missense possibly damaging 0.90
Z1192:Trpv1 UTSW 11 73,145,117 (GRCm39) missense probably benign 0.12
Z1192:Trpv1 UTSW 11 73,131,427 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTCCTGGAATTAGCAGGCAGAC -3'
(R):5'- TATGTCTAGCCTCAGGGAGC -3'

Sequencing Primer
(F):5'- ACAGAAAGGCTTGGCTGGTCTC -3'
(R):5'- GAGCCCTGAGCCTGATCTCTAC -3'
Posted On 2020-07-13