Incidental Mutation 'R8213:Efcab5'
ID 636272
Institutional Source Beutler Lab
Gene Symbol Efcab5
Ensembl Gene ENSMUSG00000050944
Gene Name EF-hand calcium binding domain 5
Synonyms 4930563A03Rik
MMRRC Submission 067655-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R8213 (G1)
Quality Score 190.009
Status Validated
Chromosome 11
Chromosomal Location 76980741-77079794 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 77006897 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 909 (Y909C)
Ref Sequence ENSEMBL: ENSMUSP00000118152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108400] [ENSMUST00000130901]
AlphaFold A0JP43
Predicted Effect probably damaging
Transcript: ENSMUST00000108400
AA Change: Y1045C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104037
Gene: ENSMUSG00000050944
AA Change: Y1045C

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
low complexity region 210 219 N/A INTRINSIC
internal_repeat_1 250 352 2.42e-20 PROSPERO
internal_repeat_1 354 452 2.42e-20 PROSPERO
low complexity region 498 513 N/A INTRINSIC
coiled coil region 749 776 N/A INTRINSIC
GAF 877 1066 1.78e-2 SMART
low complexity region 1235 1245 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130901
AA Change: Y909C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118152
Gene: ENSMUSG00000050944
AA Change: Y909C

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
internal_repeat_1 114 216 1.89e-19 PROSPERO
internal_repeat_1 218 316 1.89e-19 PROSPERO
low complexity region 362 377 N/A INTRINSIC
coiled coil region 613 640 N/A INTRINSIC
GAF 741 930 1.78e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,791,605 (GRCm39) Y277C probably damaging Het
Acss1 T A 2: 150,461,630 (GRCm39) D651V possibly damaging Het
Aktip G T 8: 91,851,494 (GRCm39) P243H possibly damaging Het
Arl11 T G 14: 61,548,714 (GRCm39) S175A probably benign Het
Aup1 A G 6: 83,031,588 (GRCm39) probably benign Het
Avil A T 10: 126,844,190 (GRCm39) I250F probably damaging Het
Btnl6 A T 17: 34,727,857 (GRCm39) probably null Het
Ccdc7b C A 8: 129,904,772 (GRCm39) Q137K probably benign Het
Cdk11b G A 4: 155,724,338 (GRCm39) E319K unknown Het
Chka A C 19: 3,935,882 (GRCm39) E196A probably damaging Het
Depdc5 C T 5: 33,094,981 (GRCm39) R753C probably damaging Het
Dhx57 T A 17: 80,582,585 (GRCm39) D340V possibly damaging Het
Dicer1 A T 12: 104,668,952 (GRCm39) D1243E probably benign Het
Dnajb9 A T 12: 44,253,916 (GRCm39) L164M probably benign Het
Dock6 A G 9: 21,742,740 (GRCm39) V785A possibly damaging Het
Erp44 A T 4: 48,208,783 (GRCm39) S226T probably benign Het
Fgd6 A T 10: 93,879,914 (GRCm39) D256V probably benign Het
Fhl5 A T 4: 25,207,113 (GRCm39) Y218* probably null Het
Filip1 C A 9: 79,725,374 (GRCm39) A1082S probably benign Het
Heatr5a G A 12: 51,938,226 (GRCm39) T1484M probably damaging Het
Herc1 G T 9: 66,358,170 (GRCm39) R2417L probably damaging Het
Hnrnpr A G 4: 136,044,486 (GRCm39) probably benign Het
Igsf5 A T 16: 96,174,188 (GRCm39) I73F probably damaging Het
Il17ra T C 6: 120,449,995 (GRCm39) V91A probably benign Het
Inpp5f A G 7: 128,281,529 (GRCm39) D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 (GRCm39) K548E probably damaging Het
Kdm5d T A Y: 941,515 (GRCm39) C1239S probably damaging Het
Mamdc4 G A 2: 25,456,368 (GRCm39) T709M probably benign Het
Mybbp1a T A 11: 72,335,547 (GRCm39) Y353N probably damaging Het
Nepn A T 10: 52,267,855 (GRCm39) E40D probably benign Het
Nhsl3 A T 4: 129,115,252 (GRCm39) V1070D possibly damaging Het
Npat G T 9: 53,481,870 (GRCm39) E1193* probably null Het
Nrde2 G A 12: 100,097,262 (GRCm39) S846L probably benign Het
Nup205 T C 6: 35,202,138 (GRCm39) V1290A probably benign Het
Or10a49 C A 7: 108,467,726 (GRCm39) V212L probably benign Het
Or4d10b A G 19: 12,036,456 (GRCm39) V220A probably benign Het
Or5g9 T A 2: 85,551,845 (GRCm39) L32Q probably null Het
Pde6a A T 18: 61,353,768 (GRCm39) K31M possibly damaging Het
Pms2 C T 5: 143,851,589 (GRCm39) R169C probably damaging Het
Polr2g A T 19: 8,775,621 (GRCm39) L30Q probably damaging Het
Pramel22 T A 4: 143,380,755 (GRCm39) M423L probably benign Het
Pramel30 A T 4: 144,057,030 (GRCm39) D71V probably benign Het
Prdm15 T A 16: 97,608,260 (GRCm39) H679L probably damaging Het
Prl4a1 T G 13: 28,207,369 (GRCm39) Y214* probably null Het
Prlr C T 15: 10,329,328 (GRCm39) T601M possibly damaging Het
Psen2 A C 1: 180,073,256 (GRCm39) S22A probably benign Het
Ralgapa1 C A 12: 55,769,699 (GRCm39) R764L probably damaging Het
Scgb2b11 T C 7: 31,908,833 (GRCm39) E89G probably damaging Het
Serpina10 T C 12: 103,594,536 (GRCm39) I228V probably benign Het
Serpinb1a T A 13: 33,026,982 (GRCm39) H320L probably damaging Het
Sesn2 C A 4: 132,225,364 (GRCm39) Q267H possibly damaging Het
Sgsm1 A T 5: 113,398,877 (GRCm39) W1019R probably damaging Het
Sqle A G 15: 59,193,151 (GRCm39) probably null Het
Syt14 T C 1: 192,669,137 (GRCm39) M39V probably benign Het
Tgm7 A G 2: 120,931,545 (GRCm39) V206A probably damaging Het
Thbs4 T C 13: 92,897,094 (GRCm39) probably null Het
Trpv1 T C 11: 73,145,077 (GRCm39) F721S probably damaging Het
Ttll10 A T 4: 156,120,691 (GRCm39) M433K probably benign Het
Vmn1r216 T C 13: 23,283,695 (GRCm39) I126T probably benign Het
Vmn2r108 G A 17: 20,690,350 (GRCm39) S494F probably benign Het
Vwa3b C T 1: 37,168,020 (GRCm39) A603V probably benign Het
Xirp2 T A 2: 67,307,210 (GRCm39) N19K probably damaging Het
Zfp397 T A 18: 24,093,779 (GRCm39) N421K probably damaging Het
Zscan5b C T 7: 6,236,946 (GRCm39) P232S possibly damaging Het
Other mutations in Efcab5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Efcab5 APN 11 77,027,862 (GRCm39) missense probably benign 0.04
IGL01343:Efcab5 APN 11 77,020,756 (GRCm39) missense probably damaging 1.00
IGL02190:Efcab5 APN 11 77,012,140 (GRCm39) missense probably benign 0.38
IGL02270:Efcab5 APN 11 76,995,139 (GRCm39) missense probably damaging 0.97
IGL02572:Efcab5 APN 11 77,028,714 (GRCm39) nonsense probably null
IGL02653:Efcab5 APN 11 77,022,848 (GRCm39) missense probably damaging 0.99
IGL02818:Efcab5 APN 11 76,996,174 (GRCm39) missense probably damaging 0.99
IGL03068:Efcab5 APN 11 76,994,927 (GRCm39) missense probably benign
IGL03222:Efcab5 APN 11 77,028,193 (GRCm39) missense probably benign 0.40
IGL03226:Efcab5 APN 11 77,028,501 (GRCm39) missense possibly damaging 0.92
IGL03257:Efcab5 APN 11 77,079,596 (GRCm39) missense probably damaging 0.99
PIT4131001:Efcab5 UTSW 11 77,028,517 (GRCm39)
PIT4418001:Efcab5 UTSW 11 77,022,877 (GRCm39) missense possibly damaging 0.89
R0276:Efcab5 UTSW 11 77,031,749 (GRCm39) missense probably damaging 1.00
R0276:Efcab5 UTSW 11 77,020,702 (GRCm39) missense probably damaging 1.00
R0277:Efcab5 UTSW 11 77,031,749 (GRCm39) missense probably damaging 1.00
R0284:Efcab5 UTSW 11 76,994,353 (GRCm39) intron probably benign
R0386:Efcab5 UTSW 11 77,063,204 (GRCm39) missense probably benign 0.30
R0386:Efcab5 UTSW 11 77,031,749 (GRCm39) missense probably damaging 1.00
R0966:Efcab5 UTSW 11 77,031,749 (GRCm39) missense probably damaging 1.00
R0968:Efcab5 UTSW 11 77,031,749 (GRCm39) missense probably damaging 1.00
R1433:Efcab5 UTSW 11 76,996,204 (GRCm39) missense probably benign 0.09
R1673:Efcab5 UTSW 11 77,042,679 (GRCm39) missense probably damaging 0.99
R1842:Efcab5 UTSW 11 77,025,701 (GRCm39) missense probably benign 0.00
R1848:Efcab5 UTSW 11 76,994,132 (GRCm39) missense probably damaging 1.00
R2069:Efcab5 UTSW 11 77,063,147 (GRCm39) missense probably benign 0.06
R3713:Efcab5 UTSW 11 77,007,008 (GRCm39) missense probably damaging 1.00
R4012:Efcab5 UTSW 11 77,008,656 (GRCm39) missense probably damaging 0.98
R4020:Efcab5 UTSW 11 76,994,930 (GRCm39) missense probably benign 0.33
R4391:Efcab5 UTSW 11 76,981,284 (GRCm39) missense probably damaging 0.99
R4392:Efcab5 UTSW 11 76,981,284 (GRCm39) missense probably damaging 0.99
R4692:Efcab5 UTSW 11 77,004,507 (GRCm39) missense probably damaging 1.00
R4929:Efcab5 UTSW 11 76,994,209 (GRCm39) missense probably benign 0.36
R4985:Efcab5 UTSW 11 77,029,055 (GRCm39) missense probably damaging 0.98
R4988:Efcab5 UTSW 11 77,028,078 (GRCm39) missense probably damaging 1.00
R5246:Efcab5 UTSW 11 77,079,671 (GRCm39) missense probably damaging 1.00
R5260:Efcab5 UTSW 11 77,028,477 (GRCm39) missense possibly damaging 0.92
R5387:Efcab5 UTSW 11 77,025,668 (GRCm39) missense possibly damaging 0.93
R5516:Efcab5 UTSW 11 77,079,615 (GRCm39) missense possibly damaging 0.62
R5535:Efcab5 UTSW 11 77,042,747 (GRCm39) missense probably damaging 1.00
R5694:Efcab5 UTSW 11 77,079,701 (GRCm39) missense probably benign 0.09
R5922:Efcab5 UTSW 11 77,079,570 (GRCm39) missense probably benign 0.44
R6030:Efcab5 UTSW 11 77,012,088 (GRCm39) missense probably damaging 1.00
R6030:Efcab5 UTSW 11 77,012,088 (GRCm39) missense probably damaging 1.00
R6183:Efcab5 UTSW 11 77,028,084 (GRCm39) missense probably benign 0.04
R6437:Efcab5 UTSW 11 77,028,728 (GRCm39) missense probably benign 0.25
R6442:Efcab5 UTSW 11 76,996,260 (GRCm39) nonsense probably null
R6592:Efcab5 UTSW 11 77,004,436 (GRCm39) missense possibly damaging 0.90
R6769:Efcab5 UTSW 11 76,996,258 (GRCm39) missense probably damaging 0.98
R7257:Efcab5 UTSW 11 77,028,605 (GRCm39) missense probably damaging 0.99
R7285:Efcab5 UTSW 11 77,029,041 (GRCm39) missense possibly damaging 0.49
R7285:Efcab5 UTSW 11 77,028,170 (GRCm39) missense probably benign
R7350:Efcab5 UTSW 11 77,028,387 (GRCm39) missense probably benign 0.05
R7369:Efcab5 UTSW 11 77,008,661 (GRCm39) missense possibly damaging 0.60
R7760:Efcab5 UTSW 11 77,042,752 (GRCm39) missense probably benign 0.31
R8690:Efcab5 UTSW 11 76,994,115 (GRCm39) missense probably damaging 0.98
R9294:Efcab5 UTSW 11 77,012,064 (GRCm39) missense probably benign 0.03
R9310:Efcab5 UTSW 11 77,004,531 (GRCm39) missense probably benign 0.23
R9324:Efcab5 UTSW 11 77,004,546 (GRCm39) missense possibly damaging 0.95
R9404:Efcab5 UTSW 11 77,022,934 (GRCm39) missense probably damaging 0.99
R9405:Efcab5 UTSW 11 77,022,934 (GRCm39) missense probably damaging 0.99
R9407:Efcab5 UTSW 11 77,022,934 (GRCm39) missense probably damaging 0.99
R9509:Efcab5 UTSW 11 76,994,977 (GRCm39) missense possibly damaging 0.94
R9562:Efcab5 UTSW 11 77,022,934 (GRCm39) missense probably damaging 0.99
R9651:Efcab5 UTSW 11 77,022,934 (GRCm39) missense probably damaging 0.99
R9748:Efcab5 UTSW 11 77,007,022 (GRCm39) nonsense probably null
X0061:Efcab5 UTSW 11 77,007,060 (GRCm39) missense probably damaging 1.00
Z1176:Efcab5 UTSW 11 77,022,965 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGATATGCATGTGTATCCCAGTC -3'
(R):5'- AGGAAAGCCAATCCATGTCC -3'

Sequencing Primer
(F):5'- GTGTATCCCAGTCTTTCTACAAATG -3'
(R):5'- GTTCAGCACCATGGAAATATCTTC -3'
Posted On 2020-07-13