Incidental Mutation 'R8213:Ralgapa1'
ID 636275
Institutional Source Beutler Lab
Gene Symbol Ralgapa1
Ensembl Gene ENSMUSG00000021027
Gene Name Ral GTPase activating protein, alpha subunit 1
Synonyms Garnl1, 4930400K19Rik, Tulip1, 2310003F20Rik
MMRRC Submission 067655-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.802) question?
Stock # R8213 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 55649681-55867952 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 55769699 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 764 (R764L)
Ref Sequence ENSEMBL: ENSMUSP00000082503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687]
AlphaFold Q6GYP7
Predicted Effect probably damaging
Transcript: ENSMUST00000085385
AA Change: R764L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: R764L

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2003 7.4e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110687
AA Change: R764L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: R764L

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2001 1.9e-48 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,791,605 (GRCm39) Y277C probably damaging Het
Acss1 T A 2: 150,461,630 (GRCm39) D651V possibly damaging Het
Aktip G T 8: 91,851,494 (GRCm39) P243H possibly damaging Het
Arl11 T G 14: 61,548,714 (GRCm39) S175A probably benign Het
Aup1 A G 6: 83,031,588 (GRCm39) probably benign Het
Avil A T 10: 126,844,190 (GRCm39) I250F probably damaging Het
Btnl6 A T 17: 34,727,857 (GRCm39) probably null Het
Ccdc7b C A 8: 129,904,772 (GRCm39) Q137K probably benign Het
Cdk11b G A 4: 155,724,338 (GRCm39) E319K unknown Het
Chka A C 19: 3,935,882 (GRCm39) E196A probably damaging Het
Depdc5 C T 5: 33,094,981 (GRCm39) R753C probably damaging Het
Dhx57 T A 17: 80,582,585 (GRCm39) D340V possibly damaging Het
Dicer1 A T 12: 104,668,952 (GRCm39) D1243E probably benign Het
Dnajb9 A T 12: 44,253,916 (GRCm39) L164M probably benign Het
Dock6 A G 9: 21,742,740 (GRCm39) V785A possibly damaging Het
Efcab5 T C 11: 77,006,897 (GRCm39) Y909C probably damaging Het
Erp44 A T 4: 48,208,783 (GRCm39) S226T probably benign Het
Fgd6 A T 10: 93,879,914 (GRCm39) D256V probably benign Het
Fhl5 A T 4: 25,207,113 (GRCm39) Y218* probably null Het
Filip1 C A 9: 79,725,374 (GRCm39) A1082S probably benign Het
Heatr5a G A 12: 51,938,226 (GRCm39) T1484M probably damaging Het
Herc1 G T 9: 66,358,170 (GRCm39) R2417L probably damaging Het
Hnrnpr A G 4: 136,044,486 (GRCm39) probably benign Het
Igsf5 A T 16: 96,174,188 (GRCm39) I73F probably damaging Het
Il17ra T C 6: 120,449,995 (GRCm39) V91A probably benign Het
Inpp5f A G 7: 128,281,529 (GRCm39) D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 (GRCm39) K548E probably damaging Het
Kdm5d T A Y: 941,515 (GRCm39) C1239S probably damaging Het
Mamdc4 G A 2: 25,456,368 (GRCm39) T709M probably benign Het
Mybbp1a T A 11: 72,335,547 (GRCm39) Y353N probably damaging Het
Nepn A T 10: 52,267,855 (GRCm39) E40D probably benign Het
Nhsl3 A T 4: 129,115,252 (GRCm39) V1070D possibly damaging Het
Npat G T 9: 53,481,870 (GRCm39) E1193* probably null Het
Nrde2 G A 12: 100,097,262 (GRCm39) S846L probably benign Het
Nup205 T C 6: 35,202,138 (GRCm39) V1290A probably benign Het
Or10a49 C A 7: 108,467,726 (GRCm39) V212L probably benign Het
Or4d10b A G 19: 12,036,456 (GRCm39) V220A probably benign Het
Or5g9 T A 2: 85,551,845 (GRCm39) L32Q probably null Het
Pde6a A T 18: 61,353,768 (GRCm39) K31M possibly damaging Het
Pms2 C T 5: 143,851,589 (GRCm39) R169C probably damaging Het
Polr2g A T 19: 8,775,621 (GRCm39) L30Q probably damaging Het
Pramel22 T A 4: 143,380,755 (GRCm39) M423L probably benign Het
Pramel30 A T 4: 144,057,030 (GRCm39) D71V probably benign Het
Prdm15 T A 16: 97,608,260 (GRCm39) H679L probably damaging Het
Prl4a1 T G 13: 28,207,369 (GRCm39) Y214* probably null Het
Prlr C T 15: 10,329,328 (GRCm39) T601M possibly damaging Het
Psen2 A C 1: 180,073,256 (GRCm39) S22A probably benign Het
Scgb2b11 T C 7: 31,908,833 (GRCm39) E89G probably damaging Het
Serpina10 T C 12: 103,594,536 (GRCm39) I228V probably benign Het
Serpinb1a T A 13: 33,026,982 (GRCm39) H320L probably damaging Het
Sesn2 C A 4: 132,225,364 (GRCm39) Q267H possibly damaging Het
Sgsm1 A T 5: 113,398,877 (GRCm39) W1019R probably damaging Het
Sqle A G 15: 59,193,151 (GRCm39) probably null Het
Syt14 T C 1: 192,669,137 (GRCm39) M39V probably benign Het
Tgm7 A G 2: 120,931,545 (GRCm39) V206A probably damaging Het
Thbs4 T C 13: 92,897,094 (GRCm39) probably null Het
Trpv1 T C 11: 73,145,077 (GRCm39) F721S probably damaging Het
Ttll10 A T 4: 156,120,691 (GRCm39) M433K probably benign Het
Vmn1r216 T C 13: 23,283,695 (GRCm39) I126T probably benign Het
Vmn2r108 G A 17: 20,690,350 (GRCm39) S494F probably benign Het
Vwa3b C T 1: 37,168,020 (GRCm39) A603V probably benign Het
Xirp2 T A 2: 67,307,210 (GRCm39) N19K probably damaging Het
Zfp397 T A 18: 24,093,779 (GRCm39) N421K probably damaging Het
Zscan5b C T 7: 6,236,946 (GRCm39) P232S possibly damaging Het
Other mutations in Ralgapa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ralgapa1 APN 12 55,769,558 (GRCm39) missense probably damaging 0.98
IGL00494:Ralgapa1 APN 12 55,793,970 (GRCm39) missense probably damaging 1.00
IGL00731:Ralgapa1 APN 12 55,749,237 (GRCm39) missense possibly damaging 0.94
IGL00851:Ralgapa1 APN 12 55,756,360 (GRCm39) missense possibly damaging 0.93
IGL01133:Ralgapa1 APN 12 55,689,144 (GRCm39) missense probably damaging 0.99
IGL01133:Ralgapa1 APN 12 55,689,133 (GRCm39) missense probably damaging 1.00
IGL01354:Ralgapa1 APN 12 55,824,101 (GRCm39) missense possibly damaging 0.68
IGL01514:Ralgapa1 APN 12 55,766,442 (GRCm39) missense probably damaging 0.97
IGL02033:Ralgapa1 APN 12 55,689,262 (GRCm39) missense possibly damaging 0.69
IGL02064:Ralgapa1 APN 12 55,754,862 (GRCm39) missense probably damaging 1.00
IGL02556:Ralgapa1 APN 12 55,689,234 (GRCm39) missense possibly damaging 0.80
IGL02605:Ralgapa1 APN 12 55,759,450 (GRCm39) missense possibly damaging 0.90
IGL02657:Ralgapa1 APN 12 55,720,292 (GRCm39) missense probably damaging 1.00
IGL02676:Ralgapa1 APN 12 55,723,202 (GRCm39) missense probably damaging 1.00
IGL02894:Ralgapa1 APN 12 55,763,854 (GRCm39) missense possibly damaging 0.79
IGL02944:Ralgapa1 APN 12 55,804,736 (GRCm39) missense probably benign 0.01
Anhydrous UTSW 12 55,842,563 (GRCm39) critical splice acceptor site probably null
Aqueous UTSW 12 55,745,639 (GRCm39) missense probably damaging 1.00
bantam UTSW 12 55,769,558 (GRCm39) critical splice donor site probably null
Deliquescent UTSW 12 55,829,685 (GRCm39) splice site probably benign
wickedwarlock UTSW 12 55,824,077 (GRCm39) missense probably null 0.99
F5770:Ralgapa1 UTSW 12 55,842,438 (GRCm39) splice site probably benign
IGL03046:Ralgapa1 UTSW 12 55,741,942 (GRCm39) missense probably damaging 1.00
R0011:Ralgapa1 UTSW 12 55,833,048 (GRCm39) missense probably damaging 0.99
R0096:Ralgapa1 UTSW 12 55,786,290 (GRCm39) missense probably damaging 1.00
R0277:Ralgapa1 UTSW 12 55,724,023 (GRCm39) missense probably damaging 0.99
R0323:Ralgapa1 UTSW 12 55,724,023 (GRCm39) missense probably damaging 0.99
R0333:Ralgapa1 UTSW 12 55,829,685 (GRCm39) splice site probably benign
R0361:Ralgapa1 UTSW 12 55,723,354 (GRCm39) missense possibly damaging 0.93
R0385:Ralgapa1 UTSW 12 55,723,823 (GRCm39) missense probably damaging 1.00
R0386:Ralgapa1 UTSW 12 55,754,852 (GRCm39) missense probably benign 0.03
R0498:Ralgapa1 UTSW 12 55,736,576 (GRCm39) missense possibly damaging 0.66
R0552:Ralgapa1 UTSW 12 55,723,550 (GRCm39) missense probably benign 0.27
R0564:Ralgapa1 UTSW 12 55,829,670 (GRCm39) missense possibly damaging 0.84
R0611:Ralgapa1 UTSW 12 55,842,483 (GRCm39) missense probably damaging 0.99
R0730:Ralgapa1 UTSW 12 55,712,448 (GRCm39) missense probably damaging 1.00
R0741:Ralgapa1 UTSW 12 55,723,366 (GRCm39) missense probably damaging 0.99
R0815:Ralgapa1 UTSW 12 55,829,562 (GRCm39) splice site probably benign
R0815:Ralgapa1 UTSW 12 55,809,466 (GRCm39) nonsense probably null
R0863:Ralgapa1 UTSW 12 55,829,562 (GRCm39) splice site probably benign
R0863:Ralgapa1 UTSW 12 55,809,466 (GRCm39) nonsense probably null
R1068:Ralgapa1 UTSW 12 55,837,095 (GRCm39) critical splice donor site probably null
R1147:Ralgapa1 UTSW 12 55,749,265 (GRCm39) missense probably damaging 1.00
R1147:Ralgapa1 UTSW 12 55,749,265 (GRCm39) missense probably damaging 1.00
R1256:Ralgapa1 UTSW 12 55,809,446 (GRCm39) missense possibly damaging 0.94
R1343:Ralgapa1 UTSW 12 55,754,763 (GRCm39) missense probably damaging 1.00
R1378:Ralgapa1 UTSW 12 55,723,711 (GRCm39) missense probably damaging 1.00
R1474:Ralgapa1 UTSW 12 55,788,265 (GRCm39) missense probably benign 0.09
R1494:Ralgapa1 UTSW 12 55,731,309 (GRCm39) missense probably damaging 0.99
R1593:Ralgapa1 UTSW 12 55,817,488 (GRCm39) missense probably damaging 1.00
R1607:Ralgapa1 UTSW 12 55,788,321 (GRCm39) missense probably damaging 1.00
R1681:Ralgapa1 UTSW 12 55,809,388 (GRCm39) missense probably benign 0.35
R1689:Ralgapa1 UTSW 12 55,723,552 (GRCm39) missense possibly damaging 0.79
R1714:Ralgapa1 UTSW 12 55,689,174 (GRCm39) missense probably damaging 1.00
R1832:Ralgapa1 UTSW 12 55,804,752 (GRCm39) missense probably benign 0.03
R1870:Ralgapa1 UTSW 12 55,723,817 (GRCm39) missense possibly damaging 0.66
R2040:Ralgapa1 UTSW 12 55,833,107 (GRCm39) missense probably damaging 1.00
R2043:Ralgapa1 UTSW 12 55,723,811 (GRCm39) missense probably damaging 0.99
R2046:Ralgapa1 UTSW 12 55,741,945 (GRCm39) missense probably damaging 1.00
R2109:Ralgapa1 UTSW 12 55,822,973 (GRCm39) missense possibly damaging 0.90
R2114:Ralgapa1 UTSW 12 55,833,134 (GRCm39) critical splice acceptor site probably null
R2115:Ralgapa1 UTSW 12 55,833,134 (GRCm39) critical splice acceptor site probably null
R2202:Ralgapa1 UTSW 12 55,659,585 (GRCm39) splice site probably null
R2203:Ralgapa1 UTSW 12 55,659,585 (GRCm39) splice site probably null
R2233:Ralgapa1 UTSW 12 55,763,856 (GRCm39) missense probably benign 0.13
R2235:Ralgapa1 UTSW 12 55,763,856 (GRCm39) missense probably benign 0.13
R2341:Ralgapa1 UTSW 12 55,723,909 (GRCm39) missense possibly damaging 0.66
R2507:Ralgapa1 UTSW 12 55,764,986 (GRCm39) missense probably damaging 1.00
R2508:Ralgapa1 UTSW 12 55,764,986 (GRCm39) missense probably damaging 1.00
R2972:Ralgapa1 UTSW 12 55,867,540 (GRCm39) missense possibly damaging 0.61
R3160:Ralgapa1 UTSW 12 55,756,371 (GRCm39) missense probably damaging 1.00
R3162:Ralgapa1 UTSW 12 55,756,371 (GRCm39) missense probably damaging 1.00
R3401:Ralgapa1 UTSW 12 55,705,922 (GRCm39) missense possibly damaging 0.66
R3416:Ralgapa1 UTSW 12 55,817,398 (GRCm39) splice site probably benign
R3499:Ralgapa1 UTSW 12 55,741,928 (GRCm39) splice site probably benign
R3799:Ralgapa1 UTSW 12 55,705,915 (GRCm39) missense probably damaging 1.00
R3948:Ralgapa1 UTSW 12 55,745,552 (GRCm39) missense probably damaging 1.00
R4039:Ralgapa1 UTSW 12 55,842,486 (GRCm39) missense probably damaging 0.99
R4120:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4165:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4166:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4212:Ralgapa1 UTSW 12 55,786,115 (GRCm39) critical splice donor site probably null
R4232:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4233:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4234:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4235:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4399:Ralgapa1 UTSW 12 55,842,563 (GRCm39) critical splice acceptor site probably null
R4698:Ralgapa1 UTSW 12 55,724,061 (GRCm39) splice site probably null
R4715:Ralgapa1 UTSW 12 55,740,243 (GRCm39) missense probably damaging 1.00
R4755:Ralgapa1 UTSW 12 55,759,533 (GRCm39) missense probably damaging 1.00
R4810:Ralgapa1 UTSW 12 55,841,778 (GRCm39) critical splice donor site probably null
R4827:Ralgapa1 UTSW 12 55,723,222 (GRCm39) missense probably damaging 1.00
R4849:Ralgapa1 UTSW 12 55,745,588 (GRCm39) missense probably damaging 0.99
R4934:Ralgapa1 UTSW 12 55,809,359 (GRCm39) missense possibly damaging 0.94
R5006:Ralgapa1 UTSW 12 55,764,899 (GRCm39) missense probably benign 0.02
R5114:Ralgapa1 UTSW 12 55,659,508 (GRCm39) missense possibly damaging 0.84
R5140:Ralgapa1 UTSW 12 55,712,459 (GRCm39) missense probably damaging 1.00
R5140:Ralgapa1 UTSW 12 55,822,937 (GRCm39) missense probably damaging 1.00
R5168:Ralgapa1 UTSW 12 55,804,817 (GRCm39) missense probably benign 0.05
R5407:Ralgapa1 UTSW 12 55,723,582 (GRCm39) missense possibly damaging 0.93
R5441:Ralgapa1 UTSW 12 55,766,408 (GRCm39) missense probably damaging 1.00
R5473:Ralgapa1 UTSW 12 55,723,495 (GRCm39) missense probably benign 0.41
R5624:Ralgapa1 UTSW 12 55,659,523 (GRCm39) missense probably damaging 1.00
R5766:Ralgapa1 UTSW 12 55,867,551 (GRCm39) start codon destroyed probably null 0.99
R5826:Ralgapa1 UTSW 12 55,723,898 (GRCm39) missense probably damaging 1.00
R5950:Ralgapa1 UTSW 12 55,785,050 (GRCm39) missense possibly damaging 0.58
R5980:Ralgapa1 UTSW 12 55,817,401 (GRCm39) splice site probably null
R6019:Ralgapa1 UTSW 12 55,730,827 (GRCm39) missense possibly damaging 0.92
R6065:Ralgapa1 UTSW 12 55,804,709 (GRCm39) critical splice donor site probably null
R6326:Ralgapa1 UTSW 12 55,793,931 (GRCm39) missense probably damaging 1.00
R6355:Ralgapa1 UTSW 12 55,745,639 (GRCm39) missense probably damaging 1.00
R6408:Ralgapa1 UTSW 12 55,730,695 (GRCm39) nonsense probably null
R6448:Ralgapa1 UTSW 12 55,766,446 (GRCm39) missense probably benign 0.14
R6453:Ralgapa1 UTSW 12 55,785,104 (GRCm39) missense probably damaging 1.00
R6590:Ralgapa1 UTSW 12 55,769,558 (GRCm39) critical splice donor site probably null
R6690:Ralgapa1 UTSW 12 55,769,558 (GRCm39) critical splice donor site probably null
R6738:Ralgapa1 UTSW 12 55,809,512 (GRCm39) missense probably damaging 1.00
R6836:Ralgapa1 UTSW 12 55,651,058 (GRCm39) splice site probably null
R6936:Ralgapa1 UTSW 12 55,832,997 (GRCm39) missense probably damaging 0.99
R6945:Ralgapa1 UTSW 12 55,822,976 (GRCm39) missense possibly damaging 0.64
R7028:Ralgapa1 UTSW 12 55,804,844 (GRCm39) missense probably damaging 1.00
R7075:Ralgapa1 UTSW 12 55,867,508 (GRCm39) missense possibly damaging 0.66
R7076:Ralgapa1 UTSW 12 55,768,361 (GRCm39) missense possibly damaging 0.82
R7098:Ralgapa1 UTSW 12 55,837,095 (GRCm39) critical splice donor site probably null
R7231:Ralgapa1 UTSW 12 55,650,976 (GRCm39) missense probably damaging 1.00
R7254:Ralgapa1 UTSW 12 55,741,978 (GRCm39) missense probably damaging 1.00
R7326:Ralgapa1 UTSW 12 55,755,789 (GRCm39) missense probably damaging 1.00
R7485:Ralgapa1 UTSW 12 55,759,457 (GRCm39) missense probably damaging 1.00
R7580:Ralgapa1 UTSW 12 55,765,013 (GRCm39) missense probably benign 0.00
R7677:Ralgapa1 UTSW 12 55,705,928 (GRCm39) missense probably damaging 0.96
R7702:Ralgapa1 UTSW 12 55,756,341 (GRCm39) missense probably damaging 1.00
R7702:Ralgapa1 UTSW 12 55,756,340 (GRCm39) missense probably damaging 1.00
R7707:Ralgapa1 UTSW 12 55,824,077 (GRCm39) missense probably null 0.99
R7723:Ralgapa1 UTSW 12 55,788,298 (GRCm39) missense probably benign
R7763:Ralgapa1 UTSW 12 55,804,740 (GRCm39) missense probably benign 0.28
R7791:Ralgapa1 UTSW 12 55,788,304 (GRCm39) missense probably damaging 0.97
R7812:Ralgapa1 UTSW 12 55,766,413 (GRCm39) missense possibly damaging 0.67
R7868:Ralgapa1 UTSW 12 55,659,423 (GRCm39) missense probably benign 0.00
R7895:Ralgapa1 UTSW 12 55,793,934 (GRCm39) missense probably benign 0.44
R7896:Ralgapa1 UTSW 12 55,744,663 (GRCm39) missense probably benign 0.01
R8004:Ralgapa1 UTSW 12 55,749,242 (GRCm39) missense probably damaging 0.99
R8094:Ralgapa1 UTSW 12 55,829,631 (GRCm39) missense probably damaging 0.99
R8307:Ralgapa1 UTSW 12 55,788,308 (GRCm39) missense probably damaging 0.99
R8423:Ralgapa1 UTSW 12 55,705,847 (GRCm39) missense probably damaging 0.99
R8462:Ralgapa1 UTSW 12 55,723,303 (GRCm39) missense possibly damaging 0.90
R8469:Ralgapa1 UTSW 12 55,786,198 (GRCm39) missense probably damaging 1.00
R8675:Ralgapa1 UTSW 12 55,785,002 (GRCm39) missense possibly damaging 0.93
R8802:Ralgapa1 UTSW 12 55,785,101 (GRCm39) missense probably damaging 0.99
R8937:Ralgapa1 UTSW 12 55,749,345 (GRCm39) missense probably damaging 0.96
R8953:Ralgapa1 UTSW 12 55,867,546 (GRCm39) missense probably damaging 0.99
R8974:Ralgapa1 UTSW 12 55,723,791 (GRCm39) missense probably benign
R9011:Ralgapa1 UTSW 12 55,652,314 (GRCm39) intron probably benign
R9089:Ralgapa1 UTSW 12 55,723,351 (GRCm39) missense probably damaging 0.97
R9124:Ralgapa1 UTSW 12 55,781,881 (GRCm39) missense probably damaging 1.00
R9254:Ralgapa1 UTSW 12 55,769,583 (GRCm39) missense probably damaging 1.00
R9320:Ralgapa1 UTSW 12 55,755,843 (GRCm39) missense possibly damaging 0.59
R9379:Ralgapa1 UTSW 12 55,769,583 (GRCm39) missense probably damaging 1.00
R9446:Ralgapa1 UTSW 12 55,754,808 (GRCm39) missense probably damaging 0.97
R9684:Ralgapa1 UTSW 12 55,659,485 (GRCm39) missense possibly damaging 0.63
Z1176:Ralgapa1 UTSW 12 55,755,865 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGACGGGATGAACTGTC -3'
(R):5'- ATTCATTGACACCACATGCCTTG -3'

Sequencing Primer
(F):5'- CGGGATGAACTGTCAACGAC -3'
(R):5'- ACACCACATGCCTTGGGTCC -3'
Posted On 2020-07-13