Incidental Mutation 'R8213:Serpinb1a'
ID 636281
Institutional Source Beutler Lab
Gene Symbol Serpinb1a
Ensembl Gene ENSMUSG00000044734
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 1a
Synonyms MNEI, LEI, 1190005M04Rik, EIA, ovalbumin, M/NEI, ELANH2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.188) question?
Stock # R8213 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 32842092-32851185 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32842999 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 320 (H320L)
Ref Sequence ENSEMBL: ENSMUSP00000075690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076352] [ENSMUST00000091668]
AlphaFold Q9D154
Predicted Effect probably damaging
Transcript: ENSMUST00000076352
AA Change: H320L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075690
Gene: ENSMUSG00000044734
AA Change: H320L

DomainStartEndE-ValueType
SERPIN 13 379 1.19e-190 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000089257
Gene: ENSMUSG00000044734
AA Change: H289L

DomainStartEndE-ValueType
SERPIN 13 348 1.5e-151 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of proteinase inhibitors. Members of this family maintain homeostasis by neutralizing overexpressed proteinase activity through their function as suicide substrates. This protein inhibits the neutrophil-derived proteinases neutrophil elastase, cathepsin G, and proteinase-3 and thus protects tissues from damage at inflammatory sites. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous null mice fail to clear P. aeruginosa lung infection and show increased mortality associated with late-onset failed bacterial clearance, partly due to elevated neutrophil necrosis, release of neutrophil protease activity, higher cytokine production and proteolysis of surfactant protein-D. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,756 Y277C probably damaging Het
Acss1 T A 2: 150,619,710 D651V possibly damaging Het
Aktip G T 8: 91,124,866 P243H possibly damaging Het
Arl11 T G 14: 61,311,265 S175A probably benign Het
Aup1 A G 6: 83,054,607 probably benign Het
Avil A T 10: 127,008,321 I250F probably damaging Het
Btnl6 A T 17: 34,508,883 probably null Het
C77080 A T 4: 129,221,459 V1070D possibly damaging Het
Ccdc7b C A 8: 129,178,291 Q137K probably benign Het
Cdk11b G A 4: 155,639,881 E319K unknown Het
Chka A C 19: 3,885,882 E196A probably damaging Het
Depdc5 C T 5: 32,937,637 R753C probably damaging Het
Dhx57 T A 17: 80,275,156 D340V possibly damaging Het
Dicer1 A T 12: 104,702,693 D1243E probably benign Het
Dnajb9 A T 12: 44,207,133 L164M probably benign Het
Dock6 A G 9: 21,831,444 V785A possibly damaging Het
Efcab5 T C 11: 77,116,071 Y909C probably damaging Het
Erp44 A T 4: 48,208,783 S226T probably benign Het
Fgd6 A T 10: 94,044,052 D256V probably benign Het
Fhl5 A T 4: 25,207,113 Y218* probably null Het
Filip1 C A 9: 79,818,092 A1082S probably benign Het
Gm13088 T A 4: 143,654,185 M423L probably benign Het
Gm13128 A T 4: 144,330,460 D71V probably benign Het
Heatr5a G A 12: 51,891,443 T1484M probably damaging Het
Herc1 G T 9: 66,450,888 R2417L probably damaging Het
Hnrnpr A G 4: 136,317,175 probably benign Het
Igsf5 A T 16: 96,372,988 I73F probably damaging Het
Il17ra T C 6: 120,473,034 V91A probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 K548E probably damaging Het
Kdm5d T A Y: 941,515 C1239S probably damaging Het
Mamdc4 G A 2: 25,566,356 T709M probably benign Het
Mybbp1a T A 11: 72,444,721 Y353N probably damaging Het
Nepn A T 10: 52,391,759 E40D probably benign Het
Npat G T 9: 53,570,570 E1193* probably null Het
Nrde2 G A 12: 100,131,003 S846L probably benign Het
Nup205 T C 6: 35,225,203 V1290A probably benign Het
Olfr1009 T A 2: 85,721,501 L32Q probably null Het
Olfr1424 A G 19: 12,059,092 V220A probably benign Het
Olfr517 C A 7: 108,868,519 V212L probably benign Het
Pde6a A T 18: 61,220,696 K31M possibly damaging Het
Pms2 C T 5: 143,914,771 R169C probably damaging Het
Polr2g A T 19: 8,798,257 L30Q probably damaging Het
Prdm15 T A 16: 97,807,060 H679L probably damaging Het
Prl4a1 T G 13: 28,023,386 Y214* probably null Het
Prlr C T 15: 10,329,242 T601M possibly damaging Het
Psen2 A C 1: 180,245,691 S22A probably benign Het
Ralgapa1 C A 12: 55,722,914 R764L probably damaging Het
Scgb2b11 T C 7: 32,209,408 E89G probably damaging Het
Serpina10 T C 12: 103,628,277 I228V probably benign Het
Sesn2 C A 4: 132,498,053 Q267H possibly damaging Het
Sgsm1 A T 5: 113,251,011 W1019R probably damaging Het
Sqle A G 15: 59,321,302 probably null Het
Syt14 T C 1: 192,986,829 M39V probably benign Het
Tgm7 A G 2: 121,101,064 V206A probably damaging Het
Thbs4 T C 13: 92,760,586 probably null Het
Trpv1 T C 11: 73,254,251 F721S probably damaging Het
Ttll10 A T 4: 156,036,234 M433K probably benign Het
Vmn1r216 T C 13: 23,099,525 I126T probably benign Het
Vmn2r108 G A 17: 20,470,088 S494F probably benign Het
Vwa3b C T 1: 37,128,939 A603V probably benign Het
Xirp2 T A 2: 67,476,866 N19K probably damaging Het
Zfp397 T A 18: 23,960,722 N421K probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Serpinb1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Serpinb1a APN 13 32845415 missense probably benign 0.03
IGL02470:Serpinb1a APN 13 32850393 missense probably damaging 0.98
IGL03215:Serpinb1a APN 13 32850369 missense probably damaging 0.99
R0047:Serpinb1a UTSW 13 32850276 missense probably damaging 1.00
R0047:Serpinb1a UTSW 13 32850276 missense probably damaging 1.00
R0121:Serpinb1a UTSW 13 32848771 splice site probably benign
R0335:Serpinb1a UTSW 13 32848656 missense probably damaging 1.00
R0387:Serpinb1a UTSW 13 32848738 missense probably benign 0.03
R0751:Serpinb1a UTSW 13 32843216 missense probably benign
R1184:Serpinb1a UTSW 13 32843216 missense probably benign
R2096:Serpinb1a UTSW 13 32847454 missense probably damaging 1.00
R2165:Serpinb1a UTSW 13 32850414 splice site probably benign
R3432:Serpinb1a UTSW 13 32842859 missense possibly damaging 0.47
R5247:Serpinb1a UTSW 13 32850406 start codon destroyed probably damaging 1.00
R5669:Serpinb1a UTSW 13 32845316 missense probably damaging 1.00
R6274:Serpinb1a UTSW 13 32842866 missense probably damaging 1.00
R7133:Serpinb1a UTSW 13 32850325 missense possibly damaging 0.69
R7358:Serpinb1a UTSW 13 32842998 missense probably damaging 1.00
R7944:Serpinb1a UTSW 13 32850256 missense probably benign 0.34
R7994:Serpinb1a UTSW 13 32843050 missense probably damaging 1.00
R8272:Serpinb1a UTSW 13 32845737 missense probably damaging 1.00
R9023:Serpinb1a UTSW 13 32845780 missense probably damaging 0.99
R9287:Serpinb1a UTSW 13 32842963 missense probably damaging 1.00
R9423:Serpinb1a UTSW 13 32842927 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AGCTCTGCCTTGTATCTGTAAAG -3'
(R):5'- ATGGACCAAACGTGAGAACTTG -3'

Sequencing Primer
(F):5'- AAAGTCTCCTTCTTCTATGGGGAAC -3'
(R):5'- GGAATTCATTGATGTCCACGTC -3'
Posted On 2020-07-13