Incidental Mutation 'R8213:Prlr'
ID 636284
Institutional Source Beutler Lab
Gene Symbol Prlr
Ensembl Gene ENSMUSG00000005268
Gene Name prolactin receptor
Synonyms Prlr-rs1, Pr-1
MMRRC Submission 067655-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.323) question?
Stock # R8213 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 10177324-10349266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 10329328 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 601 (T601M)
Ref Sequence ENSEMBL: ENSMUSP00000122219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124470] [ENSMUST00000128450] [ENSMUST00000128921] [ENSMUST00000137867] [ENSMUST00000148257]
AlphaFold Q08501
Predicted Effect possibly damaging
Transcript: ENSMUST00000124470
AA Change: T601M

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122219
Gene: ENSMUSG00000005268
AA Change: T601M

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
transmembrane domain 231 253 N/A INTRINSIC
low complexity region 278 291 N/A INTRINSIC
low complexity region 342 356 N/A INTRINSIC
low complexity region 384 397 N/A INTRINSIC
low complexity region 454 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128450
SMART Domains Protein: ENSMUSP00000122209
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128921
SMART Domains Protein: ENSMUSP00000121280
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137867
SMART Domains Protein: ENSMUSP00000121935
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148257
SMART Domains Protein: ENSMUSP00000118355
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157020
SMART Domains Protein: ENSMUSP00000120297
Gene: ENSMUSG00000094814

DomainStartEndE-ValueType
transmembrane domain 20 41 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for the anterior pituitary hormone, prolactin, and belongs to the type I cytokine receptor family. Prolactin-dependent signaling occurs as the result of ligand-induced dimerization of the prolactin receptor. Several alternatively spliced transcript variants encoding different membrane-bound and soluble isoforms have been described for this gene, which may function to modulate the endocrine and autocrine effects of prolactin in normal tissue and cancer. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal growth, hormone and glucose homeostasis, hair cycling, female reproductive behavior, morphology, and function, and thyroid, prostate, Hardarian, and lacrimal gland morphologies. Heterozygous mice exhibit defective neuron proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,791,605 (GRCm39) Y277C probably damaging Het
Acss1 T A 2: 150,461,630 (GRCm39) D651V possibly damaging Het
Aktip G T 8: 91,851,494 (GRCm39) P243H possibly damaging Het
Arl11 T G 14: 61,548,714 (GRCm39) S175A probably benign Het
Aup1 A G 6: 83,031,588 (GRCm39) probably benign Het
Avil A T 10: 126,844,190 (GRCm39) I250F probably damaging Het
Btnl6 A T 17: 34,727,857 (GRCm39) probably null Het
Ccdc7b C A 8: 129,904,772 (GRCm39) Q137K probably benign Het
Cdk11b G A 4: 155,724,338 (GRCm39) E319K unknown Het
Chka A C 19: 3,935,882 (GRCm39) E196A probably damaging Het
Depdc5 C T 5: 33,094,981 (GRCm39) R753C probably damaging Het
Dhx57 T A 17: 80,582,585 (GRCm39) D340V possibly damaging Het
Dicer1 A T 12: 104,668,952 (GRCm39) D1243E probably benign Het
Dnajb9 A T 12: 44,253,916 (GRCm39) L164M probably benign Het
Dock6 A G 9: 21,742,740 (GRCm39) V785A possibly damaging Het
Efcab5 T C 11: 77,006,897 (GRCm39) Y909C probably damaging Het
Erp44 A T 4: 48,208,783 (GRCm39) S226T probably benign Het
Fgd6 A T 10: 93,879,914 (GRCm39) D256V probably benign Het
Fhl5 A T 4: 25,207,113 (GRCm39) Y218* probably null Het
Filip1 C A 9: 79,725,374 (GRCm39) A1082S probably benign Het
Heatr5a G A 12: 51,938,226 (GRCm39) T1484M probably damaging Het
Herc1 G T 9: 66,358,170 (GRCm39) R2417L probably damaging Het
Hnrnpr A G 4: 136,044,486 (GRCm39) probably benign Het
Igsf5 A T 16: 96,174,188 (GRCm39) I73F probably damaging Het
Il17ra T C 6: 120,449,995 (GRCm39) V91A probably benign Het
Inpp5f A G 7: 128,281,529 (GRCm39) D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 (GRCm39) K548E probably damaging Het
Kdm5d T A Y: 941,515 (GRCm39) C1239S probably damaging Het
Mamdc4 G A 2: 25,456,368 (GRCm39) T709M probably benign Het
Mybbp1a T A 11: 72,335,547 (GRCm39) Y353N probably damaging Het
Nepn A T 10: 52,267,855 (GRCm39) E40D probably benign Het
Nhsl3 A T 4: 129,115,252 (GRCm39) V1070D possibly damaging Het
Npat G T 9: 53,481,870 (GRCm39) E1193* probably null Het
Nrde2 G A 12: 100,097,262 (GRCm39) S846L probably benign Het
Nup205 T C 6: 35,202,138 (GRCm39) V1290A probably benign Het
Or10a49 C A 7: 108,467,726 (GRCm39) V212L probably benign Het
Or4d10b A G 19: 12,036,456 (GRCm39) V220A probably benign Het
Or5g9 T A 2: 85,551,845 (GRCm39) L32Q probably null Het
Pde6a A T 18: 61,353,768 (GRCm39) K31M possibly damaging Het
Pms2 C T 5: 143,851,589 (GRCm39) R169C probably damaging Het
Polr2g A T 19: 8,775,621 (GRCm39) L30Q probably damaging Het
Pramel22 T A 4: 143,380,755 (GRCm39) M423L probably benign Het
Pramel30 A T 4: 144,057,030 (GRCm39) D71V probably benign Het
Prdm15 T A 16: 97,608,260 (GRCm39) H679L probably damaging Het
Prl4a1 T G 13: 28,207,369 (GRCm39) Y214* probably null Het
Psen2 A C 1: 180,073,256 (GRCm39) S22A probably benign Het
Ralgapa1 C A 12: 55,769,699 (GRCm39) R764L probably damaging Het
Scgb2b11 T C 7: 31,908,833 (GRCm39) E89G probably damaging Het
Serpina10 T C 12: 103,594,536 (GRCm39) I228V probably benign Het
Serpinb1a T A 13: 33,026,982 (GRCm39) H320L probably damaging Het
Sesn2 C A 4: 132,225,364 (GRCm39) Q267H possibly damaging Het
Sgsm1 A T 5: 113,398,877 (GRCm39) W1019R probably damaging Het
Sqle A G 15: 59,193,151 (GRCm39) probably null Het
Syt14 T C 1: 192,669,137 (GRCm39) M39V probably benign Het
Tgm7 A G 2: 120,931,545 (GRCm39) V206A probably damaging Het
Thbs4 T C 13: 92,897,094 (GRCm39) probably null Het
Trpv1 T C 11: 73,145,077 (GRCm39) F721S probably damaging Het
Ttll10 A T 4: 156,120,691 (GRCm39) M433K probably benign Het
Vmn1r216 T C 13: 23,283,695 (GRCm39) I126T probably benign Het
Vmn2r108 G A 17: 20,690,350 (GRCm39) S494F probably benign Het
Vwa3b C T 1: 37,168,020 (GRCm39) A603V probably benign Het
Xirp2 T A 2: 67,307,210 (GRCm39) N19K probably damaging Het
Zfp397 T A 18: 24,093,779 (GRCm39) N421K probably damaging Het
Zscan5b C T 7: 6,236,946 (GRCm39) P232S possibly damaging Het
Other mutations in Prlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Prlr APN 15 10,328,410 (GRCm39) missense probably benign 0.00
IGL00688:Prlr APN 15 10,322,467 (GRCm39) unclassified probably benign
IGL01527:Prlr APN 15 10,329,257 (GRCm39) missense probably benign 0.28
IGL01626:Prlr APN 15 10,328,804 (GRCm39) missense probably benign 0.12
IGL01660:Prlr APN 15 10,317,676 (GRCm39) missense probably damaging 1.00
IGL01835:Prlr APN 15 10,329,129 (GRCm39) missense probably damaging 1.00
IGL01926:Prlr APN 15 10,314,306 (GRCm39) start codon destroyed probably null 0.76
IGL01952:Prlr APN 15 10,328,428 (GRCm39) missense possibly damaging 0.95
IGL02306:Prlr APN 15 10,328,760 (GRCm39) missense probably benign 0.05
IGL02394:Prlr APN 15 10,328,664 (GRCm39) missense probably benign 0.03
IGL02430:Prlr APN 15 10,325,477 (GRCm39) missense probably damaging 1.00
IGL02695:Prlr APN 15 10,328,451 (GRCm39) missense probably benign 0.20
IGL02745:Prlr APN 15 10,328,680 (GRCm39) missense possibly damaging 0.50
IGL03193:Prlr APN 15 10,328,376 (GRCm39) missense possibly damaging 0.57
IGL03277:Prlr APN 15 10,328,887 (GRCm39) missense probably benign 0.01
IGL03379:Prlr APN 15 10,319,403 (GRCm39) missense possibly damaging 0.80
PIT4434001:Prlr UTSW 15 10,328,458 (GRCm39) missense probably damaging 1.00
R0057:Prlr UTSW 15 10,328,509 (GRCm39) missense probably damaging 0.99
R0057:Prlr UTSW 15 10,328,509 (GRCm39) missense probably damaging 0.99
R0545:Prlr UTSW 15 10,317,652 (GRCm39) missense probably damaging 1.00
R1236:Prlr UTSW 15 10,325,367 (GRCm39) missense probably benign 0.13
R1352:Prlr UTSW 15 10,328,872 (GRCm39) missense probably benign
R1524:Prlr UTSW 15 10,319,419 (GRCm39) missense probably damaging 0.97
R1537:Prlr UTSW 15 10,328,364 (GRCm39) splice site probably null
R1690:Prlr UTSW 15 10,317,676 (GRCm39) missense probably damaging 1.00
R1773:Prlr UTSW 15 10,325,404 (GRCm39) nonsense probably null
R1789:Prlr UTSW 15 10,322,622 (GRCm39) missense probably benign 0.32
R2421:Prlr UTSW 15 10,319,343 (GRCm39) missense probably damaging 1.00
R4518:Prlr UTSW 15 10,329,085 (GRCm39) missense possibly damaging 0.53
R4621:Prlr UTSW 15 10,319,462 (GRCm39) intron probably benign
R4855:Prlr UTSW 15 10,328,883 (GRCm39) missense probably benign 0.01
R4957:Prlr UTSW 15 10,319,281 (GRCm39) missense probably damaging 1.00
R5053:Prlr UTSW 15 10,325,471 (GRCm39) missense probably benign 0.00
R5731:Prlr UTSW 15 10,314,221 (GRCm39) missense probably benign 0.00
R5749:Prlr UTSW 15 10,328,804 (GRCm39) missense probably benign 0.12
R5806:Prlr UTSW 15 10,319,290 (GRCm39) missense probably damaging 1.00
R5927:Prlr UTSW 15 10,322,532 (GRCm39) missense probably benign 0.42
R6170:Prlr UTSW 15 10,328,935 (GRCm39) missense probably benign 0.05
R6911:Prlr UTSW 15 10,329,270 (GRCm39) missense probably benign
R6935:Prlr UTSW 15 10,319,388 (GRCm39) missense probably damaging 1.00
R7327:Prlr UTSW 15 10,346,524 (GRCm39) missense probably benign 0.00
R7539:Prlr UTSW 15 10,329,109 (GRCm39) missense probably benign 0.11
R7579:Prlr UTSW 15 10,329,021 (GRCm39) missense probably benign 0.08
R7615:Prlr UTSW 15 10,326,010 (GRCm39) missense probably damaging 1.00
R7651:Prlr UTSW 15 10,328,464 (GRCm39) missense probably benign 0.26
R8537:Prlr UTSW 15 10,314,266 (GRCm39) start gained probably benign
R9015:Prlr UTSW 15 10,319,352 (GRCm39) missense probably damaging 1.00
R9252:Prlr UTSW 15 10,326,550 (GRCm39) splice site probably benign
R9335:Prlr UTSW 15 10,325,357 (GRCm39) missense probably benign 0.08
R9341:Prlr UTSW 15 10,328,988 (GRCm39) missense probably benign
R9343:Prlr UTSW 15 10,328,988 (GRCm39) missense probably benign
Z1176:Prlr UTSW 15 10,314,341 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTGTTAGTGCCAGACTCAC -3'
(R):5'- TCAGCTGTTGGAAAGAGGC -3'

Sequencing Primer
(F):5'- TTAGTGCCAGACTCACGAGCC -3'
(R):5'- GCAAATGCTGAACACAAGCGTG -3'
Posted On 2020-07-13