Incidental Mutation 'R8213:A1bg'
ID 636285
Institutional Source Beutler Lab
Gene Symbol A1bg
Ensembl Gene ENSMUSG00000022347
Gene Name alpha-1-B glycoprotein
Synonyms C44
MMRRC Submission 067655-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R8213 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 60789438-60793119 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 60791605 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 277 (Y277C)
Ref Sequence ENSEMBL: ENSMUSP00000094151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096418] [ENSMUST00000228632]
AlphaFold Q19LI2
Predicted Effect probably damaging
Transcript: ENSMUST00000096418
AA Change: Y277C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000094151
Gene: ENSMUSG00000022347
AA Change: Y277C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG_like 34 109 1.09e2 SMART
Blast:IG_like 137 215 5e-15 BLAST
Pfam:Ig_2 223 314 8.8e-11 PFAM
IG 328 415 1.32e-3 SMART
IG_like 426 511 9.21e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228632
AA Change: Y84C

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228929
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss1 T A 2: 150,461,630 (GRCm39) D651V possibly damaging Het
Aktip G T 8: 91,851,494 (GRCm39) P243H possibly damaging Het
Arl11 T G 14: 61,548,714 (GRCm39) S175A probably benign Het
Aup1 A G 6: 83,031,588 (GRCm39) probably benign Het
Avil A T 10: 126,844,190 (GRCm39) I250F probably damaging Het
Btnl6 A T 17: 34,727,857 (GRCm39) probably null Het
Ccdc7b C A 8: 129,904,772 (GRCm39) Q137K probably benign Het
Cdk11b G A 4: 155,724,338 (GRCm39) E319K unknown Het
Chka A C 19: 3,935,882 (GRCm39) E196A probably damaging Het
Depdc5 C T 5: 33,094,981 (GRCm39) R753C probably damaging Het
Dhx57 T A 17: 80,582,585 (GRCm39) D340V possibly damaging Het
Dicer1 A T 12: 104,668,952 (GRCm39) D1243E probably benign Het
Dnajb9 A T 12: 44,253,916 (GRCm39) L164M probably benign Het
Dock6 A G 9: 21,742,740 (GRCm39) V785A possibly damaging Het
Efcab5 T C 11: 77,006,897 (GRCm39) Y909C probably damaging Het
Erp44 A T 4: 48,208,783 (GRCm39) S226T probably benign Het
Fgd6 A T 10: 93,879,914 (GRCm39) D256V probably benign Het
Fhl5 A T 4: 25,207,113 (GRCm39) Y218* probably null Het
Filip1 C A 9: 79,725,374 (GRCm39) A1082S probably benign Het
Heatr5a G A 12: 51,938,226 (GRCm39) T1484M probably damaging Het
Herc1 G T 9: 66,358,170 (GRCm39) R2417L probably damaging Het
Hnrnpr A G 4: 136,044,486 (GRCm39) probably benign Het
Igsf5 A T 16: 96,174,188 (GRCm39) I73F probably damaging Het
Il17ra T C 6: 120,449,995 (GRCm39) V91A probably benign Het
Inpp5f A G 7: 128,281,529 (GRCm39) D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 (GRCm39) K548E probably damaging Het
Kdm5d T A Y: 941,515 (GRCm39) C1239S probably damaging Het
Mamdc4 G A 2: 25,456,368 (GRCm39) T709M probably benign Het
Mybbp1a T A 11: 72,335,547 (GRCm39) Y353N probably damaging Het
Nepn A T 10: 52,267,855 (GRCm39) E40D probably benign Het
Nhsl3 A T 4: 129,115,252 (GRCm39) V1070D possibly damaging Het
Npat G T 9: 53,481,870 (GRCm39) E1193* probably null Het
Nrde2 G A 12: 100,097,262 (GRCm39) S846L probably benign Het
Nup205 T C 6: 35,202,138 (GRCm39) V1290A probably benign Het
Or10a49 C A 7: 108,467,726 (GRCm39) V212L probably benign Het
Or4d10b A G 19: 12,036,456 (GRCm39) V220A probably benign Het
Or5g9 T A 2: 85,551,845 (GRCm39) L32Q probably null Het
Pde6a A T 18: 61,353,768 (GRCm39) K31M possibly damaging Het
Pms2 C T 5: 143,851,589 (GRCm39) R169C probably damaging Het
Polr2g A T 19: 8,775,621 (GRCm39) L30Q probably damaging Het
Pramel22 T A 4: 143,380,755 (GRCm39) M423L probably benign Het
Pramel30 A T 4: 144,057,030 (GRCm39) D71V probably benign Het
Prdm15 T A 16: 97,608,260 (GRCm39) H679L probably damaging Het
Prl4a1 T G 13: 28,207,369 (GRCm39) Y214* probably null Het
Prlr C T 15: 10,329,328 (GRCm39) T601M possibly damaging Het
Psen2 A C 1: 180,073,256 (GRCm39) S22A probably benign Het
Ralgapa1 C A 12: 55,769,699 (GRCm39) R764L probably damaging Het
Scgb2b11 T C 7: 31,908,833 (GRCm39) E89G probably damaging Het
Serpina10 T C 12: 103,594,536 (GRCm39) I228V probably benign Het
Serpinb1a T A 13: 33,026,982 (GRCm39) H320L probably damaging Het
Sesn2 C A 4: 132,225,364 (GRCm39) Q267H possibly damaging Het
Sgsm1 A T 5: 113,398,877 (GRCm39) W1019R probably damaging Het
Sqle A G 15: 59,193,151 (GRCm39) probably null Het
Syt14 T C 1: 192,669,137 (GRCm39) M39V probably benign Het
Tgm7 A G 2: 120,931,545 (GRCm39) V206A probably damaging Het
Thbs4 T C 13: 92,897,094 (GRCm39) probably null Het
Trpv1 T C 11: 73,145,077 (GRCm39) F721S probably damaging Het
Ttll10 A T 4: 156,120,691 (GRCm39) M433K probably benign Het
Vmn1r216 T C 13: 23,283,695 (GRCm39) I126T probably benign Het
Vmn2r108 G A 17: 20,690,350 (GRCm39) S494F probably benign Het
Vwa3b C T 1: 37,168,020 (GRCm39) A603V probably benign Het
Xirp2 T A 2: 67,307,210 (GRCm39) N19K probably damaging Het
Zfp397 T A 18: 24,093,779 (GRCm39) N421K probably damaging Het
Zscan5b C T 7: 6,236,946 (GRCm39) P232S possibly damaging Het
Other mutations in A1bg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:A1bg APN 15 60,793,102 (GRCm39) missense probably damaging 0.98
IGL01622:A1bg APN 15 60,789,742 (GRCm39) missense possibly damaging 0.66
IGL01623:A1bg APN 15 60,789,742 (GRCm39) missense possibly damaging 0.66
IGL03131:A1bg APN 15 60,791,605 (GRCm39) missense probably damaging 1.00
IGL03162:A1bg APN 15 60,791,581 (GRCm39) missense probably damaging 0.99
IGL03356:A1bg APN 15 60,791,737 (GRCm39) missense probably benign 0.00
R0009:A1bg UTSW 15 60,791,482 (GRCm39) unclassified probably benign
R0009:A1bg UTSW 15 60,791,482 (GRCm39) unclassified probably benign
R0014:A1bg UTSW 15 60,791,581 (GRCm39) missense probably damaging 0.99
R1084:A1bg UTSW 15 60,790,004 (GRCm39) unclassified probably benign
R1199:A1bg UTSW 15 60,791,484 (GRCm39) critical splice donor site probably null
R4212:A1bg UTSW 15 60,791,585 (GRCm39) missense possibly damaging 0.91
R4543:A1bg UTSW 15 60,789,749 (GRCm39) missense probably damaging 1.00
R4835:A1bg UTSW 15 60,792,100 (GRCm39) missense probably benign 0.00
R5404:A1bg UTSW 15 60,791,545 (GRCm39) missense probably benign 0.02
R5553:A1bg UTSW 15 60,792,690 (GRCm39) missense probably damaging 0.98
R5580:A1bg UTSW 15 60,790,881 (GRCm39) missense probably benign 0.09
R5583:A1bg UTSW 15 60,793,083 (GRCm39) missense probably damaging 1.00
R5825:A1bg UTSW 15 60,791,976 (GRCm39) nonsense probably null
R5937:A1bg UTSW 15 60,791,495 (GRCm39) missense probably benign 0.22
R6021:A1bg UTSW 15 60,791,713 (GRCm39) missense possibly damaging 0.84
R6193:A1bg UTSW 15 60,792,629 (GRCm39) missense probably benign 0.00
R6565:A1bg UTSW 15 60,792,659 (GRCm39) missense probably damaging 1.00
R6870:A1bg UTSW 15 60,791,564 (GRCm39) missense probably damaging 1.00
R6939:A1bg UTSW 15 60,792,244 (GRCm39) missense probably damaging 0.98
R8115:A1bg UTSW 15 60,791,996 (GRCm39) missense probably benign 0.18
R9124:A1bg UTSW 15 60,792,679 (GRCm39) missense possibly damaging 0.78
Z1177:A1bg UTSW 15 60,789,923 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GGCTAAGTGGGCTCAATACG -3'
(R):5'- AAAGCAGAGTGTCCTGGACTC -3'

Sequencing Primer
(F):5'- GCTCAATACGTTCATATTTGGAGG -3'
(R):5'- AGAGTGTCCTGGACTCCTCAC -3'
Posted On 2020-07-13