Incidental Mutation 'R8213:Vmn2r108'
ID636288
Institutional Source Beutler Lab
Gene Symbol Vmn2r108
Ensembl Gene ENSMUSG00000091805
Gene Namevomeronasal 2, receptor 108
SynonymsEG627805
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R8213 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location20462373-20481236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20470088 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 494 (S494F)
Ref Sequence ENSEMBL: ENSMUSP00000130373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167314]
Predicted Effect probably benign
Transcript: ENSMUST00000167314
AA Change: S494F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000130373
Gene: ENSMUSG00000091805
AA Change: S494F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 6e-33 PFAM
Pfam:NCD3G 510 563 9.2e-22 PFAM
Pfam:7tm_3 593 831 2.2e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,756 Y277C probably damaging Het
Acss1 T A 2: 150,619,710 D651V possibly damaging Het
Aktip G T 8: 91,124,866 P243H possibly damaging Het
Arl11 T G 14: 61,311,265 S175A probably benign Het
Aup1 A G 6: 83,054,607 probably benign Het
Avil A T 10: 127,008,321 I250F probably damaging Het
Btnl6 A T 17: 34,508,883 probably null Het
C77080 A T 4: 129,221,459 V1070D possibly damaging Het
Ccdc7b C A 8: 129,178,291 Q137K probably benign Het
Cdk11b G A 4: 155,639,881 E319K unknown Het
Chka A C 19: 3,885,882 E196A probably damaging Het
Depdc5 C T 5: 32,937,637 R753C probably damaging Het
Dhx57 T A 17: 80,275,156 D340V possibly damaging Het
Dicer1 A T 12: 104,702,693 D1243E probably benign Het
Dnajb9 A T 12: 44,207,133 L164M probably benign Het
Dock6 A G 9: 21,831,444 V785A possibly damaging Het
Efcab5 T C 11: 77,116,071 Y909C probably damaging Het
Erp44 A T 4: 48,208,783 S226T probably benign Het
Fgd6 A T 10: 94,044,052 D256V probably benign Het
Fhl5 A T 4: 25,207,113 Y218* probably null Het
Filip1 C A 9: 79,818,092 A1082S probably benign Het
Gm13088 T A 4: 143,654,185 M423L probably benign Het
Gm13128 A T 4: 144,330,460 D71V probably benign Het
Heatr5a G A 12: 51,891,443 T1484M probably damaging Het
Herc1 G T 9: 66,450,888 R2417L probably damaging Het
Hnrnpr A G 4: 136,317,175 probably benign Het
Igsf5 A T 16: 96,372,988 I73F probably damaging Het
Il17ra T C 6: 120,473,034 V91A probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 K548E probably damaging Het
Kdm5d T A Y: 941,515 C1239S probably damaging Het
Mamdc4 G A 2: 25,566,356 T709M probably benign Het
Mybbp1a T A 11: 72,444,721 Y353N probably damaging Het
Nepn A T 10: 52,391,759 E40D probably benign Het
Npat G T 9: 53,570,570 E1193* probably null Het
Nrde2 G A 12: 100,131,003 S846L probably benign Het
Nup205 T C 6: 35,225,203 V1290A probably benign Het
Olfr1009 T A 2: 85,721,501 L32Q probably null Het
Olfr1424 A G 19: 12,059,092 V220A probably benign Het
Olfr517 C A 7: 108,868,519 V212L probably benign Het
Pde6a A T 18: 61,220,696 K31M possibly damaging Het
Pms2 C T 5: 143,914,771 R169C probably damaging Het
Polr2g A T 19: 8,798,257 L30Q probably damaging Het
Prdm15 T A 16: 97,807,060 H679L probably damaging Het
Prl4a1 T G 13: 28,023,386 Y214* probably null Het
Prlr C T 15: 10,329,242 T601M possibly damaging Het
Psen2 A C 1: 180,245,691 S22A probably benign Het
Ralgapa1 C A 12: 55,722,914 R764L probably damaging Het
Scgb2b11 T C 7: 32,209,408 E89G probably damaging Het
Serpina10 T C 12: 103,628,277 I228V probably benign Het
Serpinb1a T A 13: 32,842,999 H320L probably damaging Het
Sesn2 C A 4: 132,498,053 Q267H possibly damaging Het
Sgsm1 A T 5: 113,251,011 W1019R probably damaging Het
Sqle A G 15: 59,321,302 probably null Het
Syt14 T C 1: 192,986,829 M39V probably benign Het
Tgm7 A G 2: 121,101,064 V206A probably damaging Het
Thbs4 T C 13: 92,760,586 probably null Het
Trpv1 T C 11: 73,254,251 F721S probably damaging Het
Ttll10 A T 4: 156,036,234 M433K probably benign Het
Vmn1r216 T C 13: 23,099,525 I126T probably benign Het
Vwa3b C T 1: 37,128,939 A603V probably benign Het
Xirp2 T A 2: 67,476,866 N19K probably damaging Het
Zfp397 T A 18: 23,960,722 N421K probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Vmn2r108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Vmn2r108 APN 17 20462512 missense probably damaging 0.98
IGL01143:Vmn2r108 APN 17 20462465 missense possibly damaging 0.82
IGL01311:Vmn2r108 APN 17 20462677 nonsense probably null
IGL01411:Vmn2r108 APN 17 20471020 missense probably benign 0.01
IGL01414:Vmn2r108 APN 17 20471680 missense probably benign 0.00
IGL01536:Vmn2r108 APN 17 20463281 missense probably damaging 1.00
IGL01748:Vmn2r108 APN 17 20463214 missense probably benign 0.03
IGL01769:Vmn2r108 APN 17 20471018 missense probably benign 0.02
IGL02022:Vmn2r108 APN 17 20471725 missense possibly damaging 0.77
IGL02041:Vmn2r108 APN 17 20463136 missense probably damaging 1.00
IGL02049:Vmn2r108 APN 17 20471346 missense probably benign 0.00
IGL02344:Vmn2r108 APN 17 20469143 missense probably damaging 1.00
IGL02939:Vmn2r108 APN 17 20471283 missense probably benign 0.05
IGL03202:Vmn2r108 APN 17 20471057 nonsense probably null
PIT4498001:Vmn2r108 UTSW 17 20463017 missense probably damaging 1.00
R0112:Vmn2r108 UTSW 17 20471635 missense probably benign 0.07
R0505:Vmn2r108 UTSW 17 20462834 missense possibly damaging 0.77
R0833:Vmn2r108 UTSW 17 20471459 missense probably benign
R0836:Vmn2r108 UTSW 17 20471459 missense probably benign
R0943:Vmn2r108 UTSW 17 20471135 nonsense probably null
R1411:Vmn2r108 UTSW 17 20462845 missense probably damaging 0.98
R1442:Vmn2r108 UTSW 17 20472361 nonsense probably null
R1587:Vmn2r108 UTSW 17 20472121 missense probably damaging 1.00
R1751:Vmn2r108 UTSW 17 20462524 missense probably damaging 1.00
R1773:Vmn2r108 UTSW 17 20469073 missense probably damaging 1.00
R2021:Vmn2r108 UTSW 17 20470990 missense probably benign 0.00
R2159:Vmn2r108 UTSW 17 20469101 missense probably benign 0.41
R2224:Vmn2r108 UTSW 17 20481033 nonsense probably null
R2226:Vmn2r108 UTSW 17 20481033 nonsense probably null
R2517:Vmn2r108 UTSW 17 20472315 missense probably damaging 1.00
R3710:Vmn2r108 UTSW 17 20462670 missense probably benign
R4470:Vmn2r108 UTSW 17 20462728 missense probably damaging 1.00
R4686:Vmn2r108 UTSW 17 20471374 missense probably damaging 0.99
R4729:Vmn2r108 UTSW 17 20472370 missense probably damaging 0.99
R4799:Vmn2r108 UTSW 17 20462629 missense probably damaging 1.00
R4993:Vmn2r108 UTSW 17 20481187 missense probably benign 0.04
R5088:Vmn2r108 UTSW 17 20470192 missense possibly damaging 0.46
R5213:Vmn2r108 UTSW 17 20471493 missense probably benign 0.00
R5289:Vmn2r108 UTSW 17 20471604 missense probably damaging 1.00
R5290:Vmn2r108 UTSW 17 20471403 missense probably benign 0.00
R5713:Vmn2r108 UTSW 17 20471028 missense probably damaging 1.00
R5753:Vmn2r108 UTSW 17 20462917 missense probably damaging 0.99
R5792:Vmn2r108 UTSW 17 20463136 missense probably damaging 0.99
R5798:Vmn2r108 UTSW 17 20472283 missense probably benign 0.39
R5897:Vmn2r108 UTSW 17 20471318 missense probably benign 0.01
R6018:Vmn2r108 UTSW 17 20463006 missense possibly damaging 0.83
R6093:Vmn2r108 UTSW 17 20481140 missense probably benign 0.00
R6156:Vmn2r108 UTSW 17 20472185 missense probably benign 0.03
R6199:Vmn2r108 UTSW 17 20462382 missense probably benign 0.01
R6259:Vmn2r108 UTSW 17 20463109 missense possibly damaging 0.95
R6309:Vmn2r108 UTSW 17 20471398 missense probably damaging 0.98
R6324:Vmn2r108 UTSW 17 20471715 nonsense probably null
R6364:Vmn2r108 UTSW 17 20470998 missense probably benign 0.00
R6446:Vmn2r108 UTSW 17 20472347 nonsense probably null
R6541:Vmn2r108 UTSW 17 20481218 missense probably benign 0.02
R7025:Vmn2r108 UTSW 17 20471083 missense possibly damaging 0.67
R7063:Vmn2r108 UTSW 17 20481148 missense probably damaging 1.00
R7092:Vmn2r108 UTSW 17 20481076 missense probably benign 0.10
R7096:Vmn2r108 UTSW 17 20462500 missense probably damaging 1.00
R7203:Vmn2r108 UTSW 17 20462776 missense probably benign 0.12
R7458:Vmn2r108 UTSW 17 20472270 missense probably benign 0.17
R7619:Vmn2r108 UTSW 17 20472195 missense probably benign 0.02
R7841:Vmn2r108 UTSW 17 20470043 critical splice donor site probably null
R7944:Vmn2r108 UTSW 17 20471628 missense probably damaging 0.99
R8048:Vmn2r108 UTSW 17 20471500 missense probably benign 0.29
R8218:Vmn2r108 UTSW 17 20463203 missense probably damaging 1.00
R8507:Vmn2r108 UTSW 17 20462933 nonsense probably null
X0022:Vmn2r108 UTSW 17 20471109 missense probably damaging 1.00
Z1088:Vmn2r108 UTSW 17 20471113 missense probably benign 0.01
Z1177:Vmn2r108 UTSW 17 20470957 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGTACCCTATTACTACCATTGTGG -3'
(R):5'- CAATTCTGTCTCTTGGGCCTGG -3'

Sequencing Primer
(F):5'- CAGAGTGATGGGCCTTAAAT -3'
(R):5'- GCCTGGTGTGAAATTCATGAATCTC -3'
Posted On2020-07-13