Incidental Mutation 'R0723:Adcy2'
ID63629
Institutional Source Beutler Lab
Gene Symbol Adcy2
Ensembl Gene ENSMUSG00000021536
Gene Nameadenylate cyclase 2
Synonyms
MMRRC Submission 038905-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0723 (G1)
Quality Score101
Status Validated
Chromosome13
Chromosomal Location68620043-68999541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68999129 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 56 (L56P)
Ref Sequence ENSEMBL: ENSMUSP00000022013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022013]
Predicted Effect probably damaging
Transcript: ENSMUST00000022013
AA Change: L56P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022013
Gene: ENSMUSG00000021536
AA Change: L56P

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
CYCc 239 447 6.62e-66 SMART
Pfam:DUF1053 499 604 2.6e-41 PFAM
transmembrane domain 631 653 N/A INTRINSIC
low complexity region 659 673 N/A INTRINSIC
transmembrane domain 684 706 N/A INTRINSIC
transmembrane domain 738 760 N/A INTRINSIC
transmembrane domain 767 789 N/A INTRINSIC
transmembrane domain 809 826 N/A INTRINSIC
CYCc 851 1065 5.49e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223248
Meta Mutation Damage Score 0.3242 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This enzyme is insensitive to Ca(2+)/calmodulin, and is stimulated by the G protein beta and gamma subunit complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,691 N341K probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4931423N10Rik T C 2: 23,256,924 probably benign Het
8030411F24Rik T C 2: 148,783,362 I72T probably damaging Het
Acbd5 T G 2: 23,069,596 V54G probably damaging Het
Acin1 A T 14: 54,665,451 S255T probably damaging Het
Akap6 G T 12: 53,141,902 C2033F probably damaging Het
Ano5 A G 7: 51,587,758 I777V probably benign Het
Arhgef28 A G 13: 97,939,479 V1349A probably benign Het
Bank1 T C 3: 136,054,403 probably null Het
C2cd5 T C 6: 143,041,555 probably benign Het
Cadps2 A G 6: 23,287,698 V1161A probably damaging Het
Car8 A T 4: 8,169,703 D268E probably benign Het
Ckap5 T A 2: 91,555,331 S175T probably damaging Het
Clk4 T A 11: 51,275,493 Y67* probably null Het
Copg2 T C 6: 30,815,982 I473V possibly damaging Het
Cyp2s1 C T 7: 25,809,548 V43I probably benign Het
Ddx54 A G 5: 120,623,638 D493G probably benign Het
Efemp2 T C 19: 5,480,050 S140P probably damaging Het
Fam214a G A 9: 75,009,451 G444E probably damaging Het
Fat1 C A 8: 45,026,749 T2944K probably damaging Het
Fgfr1 T A 8: 25,557,768 D43E probably damaging Het
Fry G A 5: 150,496,360 A996T probably damaging Het
Fyb2 G A 4: 105,015,866 V784I probably benign Het
Gm6507 T A 6: 89,185,162 noncoding transcript Het
Gm7964 T C 7: 83,756,166 noncoding transcript Het
Gucy2c T C 6: 136,727,801 probably null Het
Hdac10 A T 15: 89,126,418 L259Q probably damaging Het
Hoxd9 A T 2: 74,698,828 D258V probably damaging Het
Hs3st3b1 T C 11: 63,921,575 T105A probably benign Het
Hsd17b7 A G 1: 169,956,026 L271P probably damaging Het
Ifnlr1 T A 4: 135,701,213 probably benign Het
Kif22 A T 7: 127,033,906 M121K probably damaging Het
Kl G A 5: 150,953,101 D129N probably damaging Het
Mettl13 A T 1: 162,534,430 I648N probably damaging Het
Mlh1 C T 9: 111,271,472 R18H probably damaging Het
Mtmr14 T C 6: 113,270,512 probably benign Het
Myo15 C A 11: 60,478,977 N854K possibly damaging Het
Myo1h T C 5: 114,319,680 I84T probably benign Het
Myo9a A T 9: 59,871,100 S1380C probably benign Het
Myof A G 19: 37,981,260 V318A probably damaging Het
N4bp2l2 A G 5: 150,662,432 S28P probably damaging Het
Narfl G A 17: 25,781,821 V406M probably damaging Het
Nbr1 C T 11: 101,576,319 Q570* probably null Het
Nhp2 C T 11: 51,619,923 Q36* probably null Het
Olfr23 T G 11: 73,940,270 V8G probably benign Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Poc1b T A 10: 99,129,595 W129R probably damaging Het
Rapgef2 C T 3: 79,079,174 E1018K probably benign Het
Rgs12 T C 5: 35,024,366 probably benign Het
Rufy2 G A 10: 62,998,094 V280I probably benign Het
Snx2 A G 18: 53,210,372 I281V probably benign Het
Spag5 C A 11: 78,319,584 probably benign Het
Stxbp5 A T 10: 9,768,873 I961N probably damaging Het
Tet2 T C 3: 133,467,284 E1739G probably benign Het
Tmod2 A G 9: 75,595,055 F50S possibly damaging Het
Tnfsf13b T G 8: 10,007,166 probably null Het
Ttn T C 2: 76,786,335 K16525E possibly damaging Het
Txnrd2 T C 16: 18,440,879 probably benign Het
Ubr1 A T 2: 120,881,101 Y1437* probably null Het
Vwf C A 6: 125,566,262 D170E probably benign Het
Wdr95 C G 5: 149,574,048 I230M probably damaging Het
Xirp2 C T 2: 67,512,215 S1600F probably damaging Het
Zfp12 A G 5: 143,244,883 K322E probably damaging Het
Other mutations in Adcy2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Adcy2 APN 13 68620796 missense probably damaging 1.00
IGL01074:Adcy2 APN 13 68796654 missense possibly damaging 0.93
IGL01394:Adcy2 APN 13 68982402 missense probably damaging 1.00
IGL01820:Adcy2 APN 13 68738545 splice site probably null
IGL02048:Adcy2 APN 13 68888067 missense possibly damaging 0.46
IGL02378:Adcy2 APN 13 68730292 missense probably damaging 1.00
IGL02419:Adcy2 APN 13 68982363 missense probably benign 0.40
IGL02896:Adcy2 APN 13 68727872 missense probably damaging 1.00
IGL02953:Adcy2 APN 13 68729328 missense probably damaging 1.00
IGL03358:Adcy2 APN 13 68729277 missense probably damaging 1.00
IGL03387:Adcy2 APN 13 68730367 missense probably damaging 1.00
PIT4305001:Adcy2 UTSW 13 68678602 missense probably benign 0.00
PIT4366001:Adcy2 UTSW 13 68709990 critical splice donor site probably benign
R0044:Adcy2 UTSW 13 68727899 missense possibly damaging 0.94
R0044:Adcy2 UTSW 13 68727899 missense possibly damaging 0.94
R0083:Adcy2 UTSW 13 68651935 missense probably damaging 0.99
R0108:Adcy2 UTSW 13 68651935 missense probably damaging 0.99
R0269:Adcy2 UTSW 13 68678606 nonsense probably null
R0369:Adcy2 UTSW 13 68671900 missense probably benign 0.00
R0480:Adcy2 UTSW 13 68732112 missense probably damaging 1.00
R0550:Adcy2 UTSW 13 68982361 missense probably benign 0.23
R0551:Adcy2 UTSW 13 68796539 missense probably damaging 1.00
R0617:Adcy2 UTSW 13 68678606 nonsense probably null
R0634:Adcy2 UTSW 13 68727945 missense possibly damaging 0.48
R0715:Adcy2 UTSW 13 68888042 missense probably benign 0.08
R1136:Adcy2 UTSW 13 68730317 missense probably damaging 1.00
R1271:Adcy2 UTSW 13 68642498 missense probably damaging 1.00
R1349:Adcy2 UTSW 13 68668533 missense probably damaging 0.98
R1372:Adcy2 UTSW 13 68668533 missense probably damaging 0.98
R1390:Adcy2 UTSW 13 68657393 missense possibly damaging 0.94
R1495:Adcy2 UTSW 13 68796535 missense probably benign 0.30
R1706:Adcy2 UTSW 13 68720746 missense probably damaging 1.00
R1839:Adcy2 UTSW 13 68689261 splice site probably null
R2004:Adcy2 UTSW 13 68796603 missense probably damaging 1.00
R2235:Adcy2 UTSW 13 68668492 missense probably damaging 0.98
R2242:Adcy2 UTSW 13 68689341 missense probably benign 0.00
R2940:Adcy2 UTSW 13 68730305 missense probably damaging 1.00
R3624:Adcy2 UTSW 13 68642531 missense probably damaging 0.99
R3689:Adcy2 UTSW 13 68630969 missense probably damaging 1.00
R4685:Adcy2 UTSW 13 68727905 missense probably benign 0.32
R4695:Adcy2 UTSW 13 68727843 missense possibly damaging 0.67
R5213:Adcy2 UTSW 13 68620823 missense possibly damaging 0.61
R5645:Adcy2 UTSW 13 68729202 splice site probably null
R5687:Adcy2 UTSW 13 68620819 nonsense probably null
R5687:Adcy2 UTSW 13 68642569 missense probably damaging 1.00
R5833:Adcy2 UTSW 13 68738603 missense probably benign
R5846:Adcy2 UTSW 13 68738588 missense probably damaging 0.99
R5894:Adcy2 UTSW 13 68625852 missense probably damaging 1.00
R6111:Adcy2 UTSW 13 68729241 missense probably damaging 0.99
R6311:Adcy2 UTSW 13 68625792 missense probably damaging 1.00
R6642:Adcy2 UTSW 13 68620826 missense probably damaging 1.00
R6644:Adcy2 UTSW 13 68668552 missense possibly damaging 0.88
R6899:Adcy2 UTSW 13 68982381 missense probably damaging 0.99
R6917:Adcy2 UTSW 13 68620757 missense possibly damaging 0.68
R6950:Adcy2 UTSW 13 68888065 missense possibly damaging 0.93
R7006:Adcy2 UTSW 13 68888020 missense probably damaging 1.00
R7186:Adcy2 UTSW 13 68668639 missense probably damaging 1.00
R7311:Adcy2 UTSW 13 68630954 missense probably damaging 1.00
R7348:Adcy2 UTSW 13 68734675 missense possibly damaging 0.79
R7440:Adcy2 UTSW 13 68796667 missense probably damaging 0.97
R7463:Adcy2 UTSW 13 68730280 missense probably damaging 1.00
R7827:Adcy2 UTSW 13 68689281 missense probably damaging 1.00
R7919:Adcy2 UTSW 13 68887972 missense probably benign 0.08
R8144:Adcy2 UTSW 13 68734635 nonsense probably null
R8256:Adcy2 UTSW 13 68620761 missense probably damaging 1.00
R8556:Adcy2 UTSW 13 68630975 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TGGGCAAAGCCTTCCAAGGAAAC -3'
(R):5'- GGGCAAGGACTCGGTCTGAAGC -3'

Sequencing Primer
(F):5'- AAGGAAACTTTTCCTCTGTCCAC -3'
(R):5'- CGGTAGGTGACCACAGAGC -3'
Posted On2013-07-30