Incidental Mutation 'R8213:Pde6a'
List |< first << previous [record 41 of 65] next >> last >|
ID636291
Institutional Source Beutler Lab
Gene Symbol Pde6a
Ensembl Gene ENSMUSG00000024575
Gene Namephosphodiesterase 6A, cGMP-specific, rod, alpha
SynonymsPdea
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8213 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location61220482-61289924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61220696 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 31 (K31M)
Ref Sequence ENSEMBL: ENSMUSP00000025468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025468]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025468
AA Change: K31M

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025468
Gene: ENSMUSG00000024575
AA Change: K31M

DomainStartEndE-ValueType
GAF 73 232 1.36e-21 SMART
GAF 254 441 3.21e-23 SMART
low complexity region 478 495 N/A INTRINSIC
Blast:HDc 496 540 3e-11 BLAST
HDc 556 734 6.95e-8 SMART
Blast:HDc 759 786 1e-8 BLAST
low complexity region 817 837 N/A INTRINSIC
low complexity region 839 853 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cyclic-GMP (cGMP)-specific phosphodiesterase 6A alpha subunit, expressed in cells of the retinal rod outer segment. The phosphodiesterase 6 holoenzyme is a heterotrimer composed of an alpha, beta, and two gamma subunits. cGMP is an important regulator of rod cell membrane current, and its dynamic concentration is established by phosphodiesterase 6A cGMP hydrolysis and guanylate cyclase cGMP synthesis. The protein is a subunit of a key phototransduction enzyme and participates in processes of transmission and amplification of the visual signal. Mutations in this gene have been identified as one cause of autosomal recessive retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,756 Y277C probably damaging Het
Acss1 T A 2: 150,619,710 D651V possibly damaging Het
Aktip G T 8: 91,124,866 P243H possibly damaging Het
Arl11 T G 14: 61,311,265 S175A probably benign Het
Aup1 A G 6: 83,054,607 probably benign Het
Avil A T 10: 127,008,321 I250F probably damaging Het
Btnl6 A T 17: 34,508,883 probably null Het
C77080 A T 4: 129,221,459 V1070D possibly damaging Het
Ccdc7b C A 8: 129,178,291 Q137K probably benign Het
Cdk11b G A 4: 155,639,881 E319K unknown Het
Chka A C 19: 3,885,882 E196A probably damaging Het
Depdc5 C T 5: 32,937,637 R753C probably damaging Het
Dhx57 T A 17: 80,275,156 D340V possibly damaging Het
Dicer1 A T 12: 104,702,693 D1243E probably benign Het
Dnajb9 A T 12: 44,207,133 L164M probably benign Het
Dock6 A G 9: 21,831,444 V785A possibly damaging Het
Efcab5 T C 11: 77,116,071 Y909C probably damaging Het
Erp44 A T 4: 48,208,783 S226T probably benign Het
Fgd6 A T 10: 94,044,052 D256V probably benign Het
Fhl5 A T 4: 25,207,113 Y218* probably null Het
Filip1 C A 9: 79,818,092 A1082S probably benign Het
Gm13088 T A 4: 143,654,185 M423L probably benign Het
Gm13128 A T 4: 144,330,460 D71V probably benign Het
Heatr5a G A 12: 51,891,443 T1484M probably damaging Het
Herc1 G T 9: 66,450,888 R2417L probably damaging Het
Hnrnpr A G 4: 136,317,175 probably benign Het
Igsf5 A T 16: 96,372,988 I73F probably damaging Het
Il17ra T C 6: 120,473,034 V91A probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 K548E probably damaging Het
Kdm5d T A Y: 941,515 C1239S probably damaging Het
Mamdc4 G A 2: 25,566,356 T709M probably benign Het
Mybbp1a T A 11: 72,444,721 Y353N probably damaging Het
Nepn A T 10: 52,391,759 E40D probably benign Het
Npat G T 9: 53,570,570 E1193* probably null Het
Nrde2 G A 12: 100,131,003 S846L probably benign Het
Nup205 T C 6: 35,225,203 V1290A probably benign Het
Olfr1009 T A 2: 85,721,501 L32Q probably null Het
Olfr1424 A G 19: 12,059,092 V220A probably benign Het
Olfr517 C A 7: 108,868,519 V212L probably benign Het
Pms2 C T 5: 143,914,771 R169C probably damaging Het
Polr2g A T 19: 8,798,257 L30Q probably damaging Het
Prdm15 T A 16: 97,807,060 H679L probably damaging Het
Prl4a1 T G 13: 28,023,386 Y214* probably null Het
Prlr C T 15: 10,329,242 T601M possibly damaging Het
Psen2 A C 1: 180,245,691 S22A probably benign Het
Ralgapa1 C A 12: 55,722,914 R764L probably damaging Het
Scgb2b11 T C 7: 32,209,408 E89G probably damaging Het
Serpina10 T C 12: 103,628,277 I228V probably benign Het
Serpinb1a T A 13: 32,842,999 H320L probably damaging Het
Sesn2 C A 4: 132,498,053 Q267H possibly damaging Het
Sgsm1 A T 5: 113,251,011 W1019R probably damaging Het
Sqle A G 15: 59,321,302 probably null Het
Syt14 T C 1: 192,986,829 M39V probably benign Het
Tgm7 A G 2: 121,101,064 V206A probably damaging Het
Thbs4 T C 13: 92,760,586 probably null Het
Trpv1 T C 11: 73,254,251 F721S probably damaging Het
Ttll10 A T 4: 156,036,234 M433K probably benign Het
Vmn1r216 T C 13: 23,099,525 I126T probably benign Het
Vmn2r108 G A 17: 20,470,088 S494F probably benign Het
Vwa3b C T 1: 37,128,939 A603V probably benign Het
Xirp2 T A 2: 67,476,866 N19K probably damaging Het
Zfp397 T A 18: 23,960,722 N421K probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Pde6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Pde6a APN 18 61257268 missense probably damaging 1.00
IGL00896:Pde6a APN 18 61220792 missense possibly damaging 0.94
IGL01595:Pde6a APN 18 61281528 missense probably damaging 0.98
IGL02971:Pde6a APN 18 61264255 missense probably damaging 1.00
caffeinated UTSW 18 61220606 start codon destroyed probably null 0.95
R0219:Pde6a UTSW 18 61285935 missense possibly damaging 0.57
R0968:Pde6a UTSW 18 61253738 missense probably damaging 0.99
R1304:Pde6a UTSW 18 61258293 missense probably damaging 0.99
R1498:Pde6a UTSW 18 61232860 missense possibly damaging 0.73
R1542:Pde6a UTSW 18 61257045 missense possibly damaging 0.93
R1734:Pde6a UTSW 18 61285965 missense probably damaging 1.00
R1795:Pde6a UTSW 18 61257212 missense probably damaging 1.00
R2173:Pde6a UTSW 18 61254382 missense probably damaging 1.00
R2280:Pde6a UTSW 18 61262434 missense probably damaging 1.00
R2281:Pde6a UTSW 18 61262434 missense probably damaging 1.00
R3617:Pde6a UTSW 18 61231503 splice site probably benign
R4620:Pde6a UTSW 18 61262492 missense probably damaging 1.00
R4727:Pde6a UTSW 18 61231489 missense probably benign 0.02
R4863:Pde6a UTSW 18 61245592 missense probably damaging 1.00
R4904:Pde6a UTSW 18 61265034 missense probably benign 0.08
R4945:Pde6a UTSW 18 61234718 missense probably damaging 1.00
R4953:Pde6a UTSW 18 61231362 nonsense probably null
R5323:Pde6a UTSW 18 61232911 missense possibly damaging 0.81
R5496:Pde6a UTSW 18 61253665 critical splice acceptor site probably null
R5540:Pde6a UTSW 18 61231366 missense probably damaging 0.99
R6180:Pde6a UTSW 18 61284092 splice site probably null
R6366:Pde6a UTSW 18 61265071 splice site probably null
R6743:Pde6a UTSW 18 61263986 missense possibly damaging 0.48
R7161:Pde6a UTSW 18 61281525 missense probably benign 0.05
R7186:Pde6a UTSW 18 61220606 start codon destroyed probably null 0.95
R7197:Pde6a UTSW 18 61258224 missense probably damaging 0.96
R7296:Pde6a UTSW 18 61258293 missense probably damaging 0.99
R7487:Pde6a UTSW 18 61249960 missense probably damaging 1.00
R7734:Pde6a UTSW 18 61232866 missense probably benign 0.10
R7818:Pde6a UTSW 18 61281509 splice site probably null
R8104:Pde6a UTSW 18 61231494 missense probably damaging 0.99
R8135:Pde6a UTSW 18 61285925 missense probably damaging 0.98
R8266:Pde6a UTSW 18 61258213 missense probably damaging 1.00
R8429:Pde6a UTSW 18 61232844 missense probably damaging 0.98
RF018:Pde6a UTSW 18 61231403 missense possibly damaging 0.84
X0064:Pde6a UTSW 18 61264948 splice site probably null
Predicted Primers PCR Primer
(F):5'- AACCTCAGATTGACGTGGGG -3'
(R):5'- ATGAACAGGCTCATGCGGTC -3'

Sequencing Primer
(F):5'- GGGCCTATTGAACTCAATTTGC -3'
(R):5'- GCCTGTAAGTTCTCCTGA -3'
Posted On2020-07-13