Incidental Mutation 'R8213:Chka'
List |< first << previous [record 11 of 65] next >> last >|
ID636292
Institutional Source Beutler Lab
Gene Symbol Chka
Ensembl Gene ENSMUSG00000024843
Gene Namecholine kinase alpha
Synonymscholine/ethanolamine kinase alpha, EtnK-alpha, CK/EK-alpha, Chk, ChoK
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8213 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location3851773-3894369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 3885882 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 196 (E196A)
Ref Sequence ENSEMBL: ENSMUSP00000071933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025760] [ENSMUST00000072055] [ENSMUST00000128694] [ENSMUST00000153343]
Predicted Effect probably damaging
Transcript: ENSMUST00000025760
AA Change: E214A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025760
Gene: ENSMUSG00000024843
AA Change: E214A

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
Pfam:APH 108 373 2.4e-11 PFAM
Pfam:Choline_kinase 135 370 8.2e-82 PFAM
Pfam:EcKinase 211 345 2.5e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072055
AA Change: E196A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071933
Gene: ENSMUSG00000024843
AA Change: E196A

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
Pfam:APH 108 358 6.4e-12 PFAM
Pfam:Choline_kinase 135 352 1.6e-84 PFAM
Pfam:EcKinase 190 329 2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125640
AA Change: E137A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000119493
Gene: ENSMUSG00000024843
AA Change: E137A

DomainStartEndE-ValueType
Pfam:Choline_kinase 40 230 2.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128694
SMART Domains Protein: ENSMUSP00000119919
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
PDB:4DA5|B 1 150 2e-60 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000139655
SMART Domains Protein: ENSMUSP00000116427
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
PDB:4DA5|B 17 160 3e-68 PDB
Predicted Effect unknown
Transcript: ENSMUST00000153343
AA Change: S67R
Meta Mutation Damage Score 0.8405 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The major pathway for the biosynthesis of phosphatidylcholine occurs via the CDP-choline pathway. The protein encoded by this gene is the initial enzyme in the sequence and may play a regulatory role. The encoded protein also catalyzes the phosphorylation of ethanolamine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality between E3.5 and E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,756 Y277C probably damaging Het
Acss1 T A 2: 150,619,710 D651V possibly damaging Het
Aktip G T 8: 91,124,866 P243H possibly damaging Het
Arl11 T G 14: 61,311,265 S175A probably benign Het
Aup1 A G 6: 83,054,607 probably benign Het
Avil A T 10: 127,008,321 I250F probably damaging Het
Btnl6 A T 17: 34,508,883 probably null Het
C77080 A T 4: 129,221,459 V1070D possibly damaging Het
Ccdc7b C A 8: 129,178,291 Q137K probably benign Het
Cdk11b G A 4: 155,639,881 E319K unknown Het
Depdc5 C T 5: 32,937,637 R753C probably damaging Het
Dhx57 T A 17: 80,275,156 D340V possibly damaging Het
Dicer1 A T 12: 104,702,693 D1243E probably benign Het
Dnajb9 A T 12: 44,207,133 L164M probably benign Het
Dock6 A G 9: 21,831,444 V785A possibly damaging Het
Efcab5 T C 11: 77,116,071 Y909C probably damaging Het
Erp44 A T 4: 48,208,783 S226T probably benign Het
Fgd6 A T 10: 94,044,052 D256V probably benign Het
Fhl5 A T 4: 25,207,113 Y218* probably null Het
Filip1 C A 9: 79,818,092 A1082S probably benign Het
Gm13088 T A 4: 143,654,185 M423L probably benign Het
Gm13128 A T 4: 144,330,460 D71V probably benign Het
Heatr5a G A 12: 51,891,443 T1484M probably damaging Het
Herc1 G T 9: 66,450,888 R2417L probably damaging Het
Hnrnpr A G 4: 136,317,175 probably benign Het
Igsf5 A T 16: 96,372,988 I73F probably damaging Het
Il17ra T C 6: 120,473,034 V91A probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 K548E probably damaging Het
Kdm5d T A Y: 941,515 C1239S probably damaging Het
Mamdc4 G A 2: 25,566,356 T709M probably benign Het
Mybbp1a T A 11: 72,444,721 Y353N probably damaging Het
Nepn A T 10: 52,391,759 E40D probably benign Het
Npat G T 9: 53,570,570 E1193* probably null Het
Nrde2 G A 12: 100,131,003 S846L probably benign Het
Nup205 T C 6: 35,225,203 V1290A probably benign Het
Olfr1009 T A 2: 85,721,501 L32Q probably null Het
Olfr1424 A G 19: 12,059,092 V220A probably benign Het
Olfr517 C A 7: 108,868,519 V212L probably benign Het
Pde6a A T 18: 61,220,696 K31M possibly damaging Het
Pms2 C T 5: 143,914,771 R169C probably damaging Het
Polr2g A T 19: 8,798,257 L30Q probably damaging Het
Prdm15 T A 16: 97,807,060 H679L probably damaging Het
Prl4a1 T G 13: 28,023,386 Y214* probably null Het
Prlr C T 15: 10,329,242 T601M possibly damaging Het
Psen2 A C 1: 180,245,691 S22A probably benign Het
Ralgapa1 C A 12: 55,722,914 R764L probably damaging Het
Scgb2b11 T C 7: 32,209,408 E89G probably damaging Het
Serpina10 T C 12: 103,628,277 I228V probably benign Het
Serpinb1a T A 13: 32,842,999 H320L probably damaging Het
Sesn2 C A 4: 132,498,053 Q267H possibly damaging Het
Sgsm1 A T 5: 113,251,011 W1019R probably damaging Het
Sqle A G 15: 59,321,302 probably null Het
Syt14 T C 1: 192,986,829 M39V probably benign Het
Tgm7 A G 2: 121,101,064 V206A probably damaging Het
Thbs4 T C 13: 92,760,586 probably null Het
Trpv1 T C 11: 73,254,251 F721S probably damaging Het
Ttll10 A T 4: 156,036,234 M433K probably benign Het
Vmn1r216 T C 13: 23,099,525 I126T probably benign Het
Vmn2r108 G A 17: 20,470,088 S494F probably benign Het
Vwa3b C T 1: 37,128,939 A603V probably benign Het
Xirp2 T A 2: 67,476,866 N19K probably damaging Het
Zfp397 T A 18: 23,960,722 N421K probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Chka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Chka APN 19 3892189 missense probably benign 0.16
IGL02630:Chka APN 19 3892112 missense possibly damaging 0.94
R1432:Chka UTSW 19 3874809 splice site probably benign
R1840:Chka UTSW 19 3886460 missense probably benign 0.00
R1898:Chka UTSW 19 3892205 missense probably damaging 1.00
R3822:Chka UTSW 19 3882038 intron probably benign
R4272:Chka UTSW 19 3875737 splice site probably benign
R4329:Chka UTSW 19 3875803 splice site probably benign
R4573:Chka UTSW 19 3885960 missense probably damaging 1.00
R4720:Chka UTSW 19 3886375 missense probably damaging 0.99
R4923:Chka UTSW 19 3892105 critical splice acceptor site probably null
R5783:Chka UTSW 19 3864661 missense probably damaging 1.00
R5936:Chka UTSW 19 3884580 missense probably benign 0.25
R5979:Chka UTSW 19 3884513 missense probably damaging 1.00
R7429:Chka UTSW 19 3892787 missense probably damaging 1.00
R7430:Chka UTSW 19 3892787 missense probably damaging 1.00
R8189:Chka UTSW 19 3875759 nonsense probably null
R8397:Chka UTSW 19 3852414 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCACCTGTGGAGATGCTGTC -3'
(R):5'- GTAATGGCATGCACACCCATG -3'

Sequencing Primer
(F):5'- TGTAAAACCAGACTGGCCTTG -3'
(R):5'- AAAGGGGTCTCTGAGCACC -3'
Posted On2020-07-13