Incidental Mutation 'R8213:Polr2g'
ID636293
Institutional Source Beutler Lab
Gene Symbol Polr2g
Ensembl Gene ENSMUSG00000071662
Gene Namepolymerase (RNA) II (DNA directed) polypeptide G
Synonyms2410046K11Rik, RBP7, A230108L04Rik, Rpo2-7l
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R8213 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location8793129-8798557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8798257 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 30 (L30Q)
Ref Sequence ENSEMBL: ENSMUSP00000093980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096261] [ENSMUST00000172175]
Predicted Effect probably damaging
Transcript: ENSMUST00000096261
AA Change: L30Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093980
Gene: ENSMUSG00000071662
AA Change: L30Q

DomainStartEndE-ValueType
Pfam:SHS2_Rpb7-N 8 77 1e-18 PFAM
S1 80 162 1.75e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172175
SMART Domains Protein: ENSMUSP00000127746
Gene: ENSMUSG00000071661

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
BTB 24 123 4.37e-21 SMART
low complexity region 207 225 N/A INTRINSIC
low complexity region 273 292 N/A INTRINSIC
low complexity region 386 406 N/A INTRINSIC
ZnF_C2H2 418 440 7.55e-1 SMART
ZnF_C2H2 446 469 3.11e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the seventh largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The protein functions in transcription initiation, and is also thought to help stabilize transcribing polyermase molecules during elongation. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,756 Y277C probably damaging Het
Acss1 T A 2: 150,619,710 D651V possibly damaging Het
Aktip G T 8: 91,124,866 P243H possibly damaging Het
Arl11 T G 14: 61,311,265 S175A probably benign Het
Aup1 A G 6: 83,054,607 probably benign Het
Avil A T 10: 127,008,321 I250F probably damaging Het
C77080 A T 4: 129,221,459 V1070D possibly damaging Het
Ccdc7b C A 8: 129,178,291 Q137K probably benign Het
Cdk11b G A 4: 155,639,881 E319K unknown Het
Chka A C 19: 3,885,882 E196A probably damaging Het
Depdc5 C T 5: 32,937,637 R753C probably damaging Het
Dhx57 T A 17: 80,275,156 D340V possibly damaging Het
Dicer1 A T 12: 104,702,693 D1243E probably benign Het
Dnajb9 A T 12: 44,207,133 L164M probably benign Het
Dock6 A G 9: 21,831,444 V785A possibly damaging Het
Efcab5 T C 11: 77,116,071 Y909C probably damaging Het
Erp44 A T 4: 48,208,783 S226T probably benign Het
Fgd6 A T 10: 94,044,052 D256V probably benign Het
Fhl5 A T 4: 25,207,113 Y218* probably null Het
Filip1 C A 9: 79,818,092 A1082S probably benign Het
Gm13088 T A 4: 143,654,185 M423L probably benign Het
Gm13128 A T 4: 144,330,460 D71V probably benign Het
Heatr5a G A 12: 51,891,443 T1484M probably damaging Het
Herc1 G T 9: 66,450,888 R2417L probably damaging Het
Hnrnpr A G 4: 136,317,175 probably benign Het
Igsf5 A T 16: 96,372,988 I73F probably damaging Het
Il17ra T C 6: 120,473,034 V91A probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Kbtbd3 A G 9: 4,331,269 K548E probably damaging Het
Kdm5d T A Y: 941,515 C1239S probably damaging Het
Mamdc4 G A 2: 25,566,356 T709M probably benign Het
Mybbp1a T A 11: 72,444,721 Y353N probably damaging Het
Nepn A T 10: 52,391,759 E40D probably benign Het
Npat G T 9: 53,570,570 E1193* probably null Het
Nrde2 G A 12: 100,131,003 S846L probably benign Het
Nup205 T C 6: 35,225,203 V1290A probably benign Het
Olfr1009 T A 2: 85,721,501 L32Q probably null Het
Olfr1424 A G 19: 12,059,092 V220A probably benign Het
Olfr517 C A 7: 108,868,519 V212L probably benign Het
Pde6a A T 18: 61,220,696 K31M possibly damaging Het
Pms2 C T 5: 143,914,771 R169C probably damaging Het
Prdm15 T A 16: 97,807,060 H679L probably damaging Het
Prl4a1 T G 13: 28,023,386 Y214* probably null Het
Prlr C T 15: 10,329,242 T601M possibly damaging Het
Psen2 A C 1: 180,245,691 S22A probably benign Het
Ralgapa1 C A 12: 55,722,914 R764L probably damaging Het
Scgb2b11 T C 7: 32,209,408 E89G probably damaging Het
Serpina10 T C 12: 103,628,277 I228V probably benign Het
Serpinb1a T A 13: 32,842,999 H320L probably damaging Het
Sesn2 C A 4: 132,498,053 Q267H possibly damaging Het
Sgsm1 A T 5: 113,251,011 W1019R probably damaging Het
Syt14 T C 1: 192,986,829 M39V probably benign Het
Tgm7 A G 2: 121,101,064 V206A probably damaging Het
Thbs4 T C 13: 92,760,586 probably null Het
Trpv1 T C 11: 73,254,251 F721S probably damaging Het
Ttll10 A T 4: 156,036,234 M433K probably benign Het
Vmn1r216 T C 13: 23,099,525 I126T probably benign Het
Vmn2r108 G A 17: 20,470,088 S494F probably benign Het
Vwa3b C T 1: 37,128,939 A603V probably benign Het
Xirp2 T A 2: 67,476,866 N19K probably damaging Het
Zfp397 T A 18: 23,960,722 N421K probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Polr2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Polr2g APN 19 8794376 splice site probably benign
IGL02474:Polr2g APN 19 8798456 splice site probably null
IGL03346:Polr2g APN 19 8798305 missense probably damaging 1.00
R0014:Polr2g UTSW 19 8793652 missense probably damaging 0.99
R0015:Polr2g UTSW 19 8793652 missense probably damaging 0.99
R0015:Polr2g UTSW 19 8793652 missense probably damaging 0.99
R5372:Polr2g UTSW 19 8797303 missense probably damaging 1.00
R6073:Polr2g UTSW 19 8797309 missense probably damaging 0.99
R6177:Polr2g UTSW 19 8794177 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAACTGGCTGCTTCAGGTG -3'
(R):5'- CTGCAGAAGATGTTTTATCACGTGAG -3'

Sequencing Primer
(F):5'- CTGCTTCAGGTGCCTGG -3'
(R):5'- ATCACGTGAGCTGGATGC -3'
Posted On2020-07-13