Incidental Mutation 'R8214:Dnpep'
ID636297
Institutional Source Beutler Lab
Gene Symbol Dnpep
Ensembl Gene ENSMUSG00000026209
Gene Nameaspartyl aminopeptidase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8214 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location75307896-75317990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75315998 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 126 (W126R)
Ref Sequence ENSEMBL: ENSMUSP00000140864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066668] [ENSMUST00000113605] [ENSMUST00000185419] [ENSMUST00000185797] [ENSMUST00000187000] [ENSMUST00000187075] [ENSMUST00000187836] [ENSMUST00000188652] [ENSMUST00000189282] [ENSMUST00000189551] [ENSMUST00000191254]
Predicted Effect
SMART Domains Protein: ENSMUSP00000070821
Gene: ENSMUSG00000026209
AA Change: W124R

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 460 2.9e-199 PFAM
Pfam:Peptidase_M42 328 455 1.2e-7 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000109235
Gene: ENSMUSG00000026209
AA Change: W124R

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 460 9.4e-194 PFAM
Pfam:Peptidase_M42 328 455 1.1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185419
AA Change: W124R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140035
Gene: ENSMUSG00000026209
AA Change: W124R

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 459 7.3e-192 PFAM
Pfam:Peptidase_M42 328 455 1.1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185797
AA Change: W126R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140864
Gene: ENSMUSG00000026209
AA Change: W126R

DomainStartEndE-ValueType
Pfam:Peptidase_M18 24 462 2e-190 PFAM
Pfam:Peptidase_M42 330 457 1.9e-4 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000141014
Gene: ENSMUSG00000026209
AA Change: W124R

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 271 2.9e-102 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000140877
Gene: ENSMUSG00000026209
AA Change: W124R

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 222 1.1e-80 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000139739
Gene: ENSMUSG00000026209
AA Change: W124R

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 460 9.4e-194 PFAM
Pfam:Peptidase_M42 328 455 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188652
SMART Domains Protein: ENSMUSP00000139532
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 85 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189282
SMART Domains Protein: ENSMUSP00000141187
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 57 1.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189551
AA Change: W124R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140563
Gene: ENSMUSG00000026209
AA Change: W124R

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 198 6.4e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191254
AA Change: W88R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140997
Gene: ENSMUSG00000026209
AA Change: W88R

DomainStartEndE-ValueType
Pfam:Peptidase_M18 24 64 8.8e-11 PFAM
Pfam:Peptidase_M18 60 92 3.6e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an aminopeptidase which prefers acidic amino acids, and specifically favors aspartic acid over glutamic acid. It is thought to be a cytosolic protein involved in general metabolism of intracellular proteins. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,286,621 R52Q Het
Abcc3 C T 11: 94,363,518 R718H probably damaging Het
Abcc4 T C 14: 118,500,841 M1166V probably benign Het
Abhd16b C T 2: 181,494,190 T295I probably damaging Het
Amph A G 13: 19,104,298 N319S possibly damaging Het
Ankrd27 A G 7: 35,614,519 D425G probably damaging Het
Atg4b T C 1: 93,784,887 S316P probably damaging Het
Brd4 A G 17: 32,212,947 S649P probably benign Het
Bzw1 T C 1: 58,405,037 S411P probably damaging Het
Dnah6 T C 6: 73,044,728 D3537G probably damaging Het
Efcab2 T C 1: 178,437,450 V27A probably benign Het
Kctd21 T C 7: 97,347,341 L7P probably damaging Het
Kidins220 C T 12: 24,994,855 T216I probably damaging Het
Lpl T A 8: 68,892,605 M87K probably damaging Het
Lrrc16a T C 13: 24,044,232 E987G probably damaging Het
Ltn1 A G 16: 87,380,803 V1646A probably benign Het
Madcam1 A G 10: 79,666,758 T359A probably benign Het
Muc5ac A G 7: 141,802,948 K1092E possibly damaging Het
Nrg2 T C 18: 36,196,676 E162G probably benign Het
Olfr1333 A T 4: 118,830,091 F117L probably benign Het
Olfr474 T A 7: 107,954,967 S109T probably benign Het
Olfr589 A C 7: 103,155,406 S114A probably damaging Het
Pcdhb5 G T 18: 37,321,583 V339L probably benign Het
Plec A G 15: 76,192,284 W145R unknown Het
Polr3f A G 2: 144,536,310 N201D probably benign Het
Skint5 T C 4: 113,804,942 probably null Het
Slc12a2 A G 18: 57,937,719 I1048V probably benign Het
Sult2a4 A G 7: 13,989,476 I39T probably benign Het
Tenm4 T C 7: 96,895,407 V2247A probably damaging Het
Tg C T 15: 66,773,398 R2385C probably damaging Het
Tomm70a G T 16: 57,121,967 A36S unknown Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Unc45b A G 11: 82,933,888 I629M possibly damaging Het
Vmn1r16 T C 6: 57,323,439 E66G noncoding transcript Het
Vmn1r189 C T 13: 22,102,131 V179I probably benign Het
Vmn2r105 T G 17: 20,228,513 E134A probably benign Het
Wdr70 G A 15: 7,887,370 A522V probably benign Het
Zcchc11 A G 4: 108,512,150 I636V probably benign Het
Zfp184 T A 13: 21,958,825 C234S probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Dnpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Dnpep APN 1 75315688 missense probably damaging 1.00
P0026:Dnpep UTSW 1 75308685 missense probably benign 0.01
R0126:Dnpep UTSW 1 75312538 nonsense probably null
R0318:Dnpep UTSW 1 75316626 missense probably damaging 1.00
R0669:Dnpep UTSW 1 75311778 unclassified probably benign
R1076:Dnpep UTSW 1 75315938 unclassified probably benign
R1478:Dnpep UTSW 1 75316027 missense probably damaging 1.00
R1803:Dnpep UTSW 1 75309414 nonsense probably null
R3409:Dnpep UTSW 1 75316626 missense probably damaging 1.00
R3411:Dnpep UTSW 1 75316626 missense probably damaging 1.00
R4590:Dnpep UTSW 1 75316401 missense probably damaging 1.00
R4863:Dnpep UTSW 1 75309230 intron probably benign
R4948:Dnpep UTSW 1 75316760 missense probably benign 0.13
R5873:Dnpep UTSW 1 75315143 missense probably damaging 1.00
R5891:Dnpep UTSW 1 75311812 missense probably benign
R5907:Dnpep UTSW 1 75311991 critical splice donor site probably null
R6143:Dnpep UTSW 1 75315228 missense probably damaging 1.00
R6432:Dnpep UTSW 1 75315378 missense probably benign 0.12
R6433:Dnpep UTSW 1 75315378 missense probably benign 0.12
R7188:Dnpep UTSW 1 75316057 missense probably damaging 1.00
R7189:Dnpep UTSW 1 75313430 missense probably damaging 1.00
R7620:Dnpep UTSW 1 75313448 missense probably benign 0.02
R7682:Dnpep UTSW 1 75316740 missense probably damaging 1.00
R7770:Dnpep UTSW 1 75317246 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGGGCCGTTCTATATGGACG -3'
(R):5'- AACTGATGTGCTATCTGCTCTG -3'

Sequencing Primer
(F):5'- CTATATGGACGAGCCTCTGC -3'
(R):5'- GCTCTGTATAACTTACTGCCTGAG -3'
Posted On2020-07-13