Incidental Mutation 'R8214:Atg4b'
ID636298
Institutional Source Beutler Lab
Gene Symbol Atg4b
Ensembl Gene ENSMUSG00000026280
Gene Nameautophagy related 4B, cysteine peptidase
Synonyms2510009N07Rik, autophagin 1, Apg4b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R8214 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93751500-93790610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93784887 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 316 (S316P)
Ref Sequence ENSEMBL: ENSMUSP00000027502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027502] [ENSMUST00000185482] [ENSMUST00000186811]
Predicted Effect probably damaging
Transcript: ENSMUST00000027502
AA Change: S316P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027502
Gene: ENSMUSG00000026280
AA Change: S316P

DomainStartEndE-ValueType
Pfam:Peptidase_C54 39 335 4.4e-104 PFAM
low complexity region 375 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185482
SMART Domains Protein: ENSMUSP00000140758
Gene: ENSMUSG00000026280

DomainStartEndE-ValueType
Pfam:Peptidase_C54 36 137 2.3e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186811
AA Change: S31P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139463
Gene: ENSMUSG00000026280
AA Change: S31P

DomainStartEndE-ValueType
Pfam:Peptidase_C54 2 52 6.5e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene encodes a member of the autophagin protein family. The encoded protein is also designated as a member of the C-54 family of cysteine proteases. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased autophagy, impaired swimming, circling, head tilting, and abnormal utricle, saccular, and otolith morphology. Mice homozygous for another gene trap allele exhibit partial preweaning lethality and impaired motor coordination and learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,286,621 R52Q Het
Abcc3 C T 11: 94,363,518 R718H probably damaging Het
Abcc4 T C 14: 118,500,841 M1166V probably benign Het
Abhd16b C T 2: 181,494,190 T295I probably damaging Het
Amph A G 13: 19,104,298 N319S possibly damaging Het
Ankrd27 A G 7: 35,614,519 D425G probably damaging Het
Brd4 A G 17: 32,212,947 S649P probably benign Het
Bzw1 T C 1: 58,405,037 S411P probably damaging Het
Dnah6 T C 6: 73,044,728 D3537G probably damaging Het
Dnpep A T 1: 75,315,998 W126R probably damaging Het
Efcab2 T C 1: 178,437,450 V27A probably benign Het
Kctd21 T C 7: 97,347,341 L7P probably damaging Het
Kidins220 C T 12: 24,994,855 T216I probably damaging Het
Lpl T A 8: 68,892,605 M87K probably damaging Het
Lrrc16a T C 13: 24,044,232 E987G probably damaging Het
Ltn1 A G 16: 87,380,803 V1646A probably benign Het
Madcam1 A G 10: 79,666,758 T359A probably benign Het
Muc5ac A G 7: 141,802,948 K1092E possibly damaging Het
Nrg2 T C 18: 36,196,676 E162G probably benign Het
Olfr1333 A T 4: 118,830,091 F117L probably benign Het
Olfr474 T A 7: 107,954,967 S109T probably benign Het
Olfr589 A C 7: 103,155,406 S114A probably damaging Het
Pcdhb5 G T 18: 37,321,583 V339L probably benign Het
Plec A G 15: 76,192,284 W145R unknown Het
Polr3f A G 2: 144,536,310 N201D probably benign Het
Skint5 T C 4: 113,804,942 probably null Het
Slc12a2 A G 18: 57,937,719 I1048V probably benign Het
Sult2a4 A G 7: 13,989,476 I39T probably benign Het
Tenm4 T C 7: 96,895,407 V2247A probably damaging Het
Tg C T 15: 66,773,398 R2385C probably damaging Het
Tomm70a G T 16: 57,121,967 A36S unknown Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Unc45b A G 11: 82,933,888 I629M possibly damaging Het
Vmn1r16 T C 6: 57,323,439 E66G noncoding transcript Het
Vmn1r189 C T 13: 22,102,131 V179I probably benign Het
Vmn2r105 T G 17: 20,228,513 E134A probably benign Het
Wdr70 G A 15: 7,887,370 A522V probably benign Het
Zcchc11 A G 4: 108,512,150 I636V probably benign Het
Zfp184 T A 13: 21,958,825 C234S probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Atg4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01832:Atg4b APN 1 93785904 splice site probably benign
IGL01875:Atg4b APN 1 93778310 missense probably damaging 1.00
IGL02884:Atg4b APN 1 93787715 utr 3 prime probably benign
R0050:Atg4b UTSW 1 93787718 utr 3 prime probably benign
R0050:Atg4b UTSW 1 93787718 utr 3 prime probably benign
R0387:Atg4b UTSW 1 93786556 missense probably benign 0.02
R0533:Atg4b UTSW 1 93784910 splice site probably benign
R2382:Atg4b UTSW 1 93784842 missense probably damaging 1.00
R3113:Atg4b UTSW 1 93775704 splice site probably benign
R3730:Atg4b UTSW 1 93768275 missense probably damaging 0.99
R4303:Atg4b UTSW 1 93768262 missense probably benign 0.02
R4612:Atg4b UTSW 1 93786541 missense probably damaging 1.00
R5027:Atg4b UTSW 1 93786575 missense probably benign 0.00
R5048:Atg4b UTSW 1 93775658 missense possibly damaging 0.75
R5427:Atg4b UTSW 1 93775206 missense probably damaging 1.00
R5735:Atg4b UTSW 1 93773797 missense probably damaging 1.00
R7209:Atg4b UTSW 1 93775233 missense probably damaging 1.00
R8194:Atg4b UTSW 1 93785972 nonsense probably null
R8724:Atg4b UTSW 1 93768301 missense probably damaging 0.99
R8949:Atg4b UTSW 1 93787757 makesense probably null
Predicted Primers PCR Primer
(F):5'- AGGCACTTTGATTGCTACCTC -3'
(R):5'- CGGTACATCCACTCAATCAGTC -3'

Sequencing Primer
(F):5'- TCTGGATGCTGCTCTGGCC -3'
(R):5'- GTCAACACTCGAATATACTGGGGTTG -3'
Posted On2020-07-13