Incidental Mutation 'R8214:Polr3f'
ID636300
Institutional Source Beutler Lab
Gene Symbol Polr3f
Ensembl Gene ENSMUSG00000027427
Gene Namepolymerase (RNA) III (DNA directed) polypeptide F
Synonyms3110032A07Rik, 3010019O03Rik, RPC6, RPC39, 2810411G20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8214 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location144527718-144541995 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144536310 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 201 (N201D)
Ref Sequence ENSEMBL: ENSMUSP00000028914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028914] [ENSMUST00000110017]
PDB Structure Solution structure of rpc34 subunit in RNA polymerase III from mouse [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000028914
AA Change: N201D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028914
Gene: ENSMUSG00000027427
AA Change: N201D

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpc34 1 315 6.8e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110017
SMART Domains Protein: ENSMUSP00000105644
Gene: ENSMUSG00000027427

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpc34 1 105 6.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155567
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of more than a dozen subunits forming eukaryotic RNA polymerase III (RNA Pol III), which transcribes 5S ribosomal RNA and tRNA genes. This protein has been shown to bind both TFIIIB90 and TBP, two subunits of RNA polymerase III transcription initiation factor IIIB (TFIIIB). Unlike most of the other RNA Pol III subunits, the encoded protein is unique to this polymerase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,286,621 R52Q Het
Abcc3 C T 11: 94,363,518 R718H probably damaging Het
Abcc4 T C 14: 118,500,841 M1166V probably benign Het
Abhd16b C T 2: 181,494,190 T295I probably damaging Het
Amph A G 13: 19,104,298 N319S possibly damaging Het
Ankrd27 A G 7: 35,614,519 D425G probably damaging Het
Atg4b T C 1: 93,784,887 S316P probably damaging Het
Brd4 A G 17: 32,212,947 S649P probably benign Het
Bzw1 T C 1: 58,405,037 S411P probably damaging Het
Dnah6 T C 6: 73,044,728 D3537G probably damaging Het
Dnpep A T 1: 75,315,998 W126R probably damaging Het
Efcab2 T C 1: 178,437,450 V27A probably benign Het
Kctd21 T C 7: 97,347,341 L7P probably damaging Het
Kidins220 C T 12: 24,994,855 T216I probably damaging Het
Lpl T A 8: 68,892,605 M87K probably damaging Het
Lrrc16a T C 13: 24,044,232 E987G probably damaging Het
Ltn1 A G 16: 87,380,803 V1646A probably benign Het
Madcam1 A G 10: 79,666,758 T359A probably benign Het
Muc5ac A G 7: 141,802,948 K1092E possibly damaging Het
Nrg2 T C 18: 36,196,676 E162G probably benign Het
Olfr1333 A T 4: 118,830,091 F117L probably benign Het
Olfr474 T A 7: 107,954,967 S109T probably benign Het
Olfr589 A C 7: 103,155,406 S114A probably damaging Het
Pcdhb5 G T 18: 37,321,583 V339L probably benign Het
Plec A G 15: 76,192,284 W145R unknown Het
Skint5 T C 4: 113,804,942 probably null Het
Slc12a2 A G 18: 57,937,719 I1048V probably benign Het
Sult2a4 A G 7: 13,989,476 I39T probably benign Het
Tenm4 T C 7: 96,895,407 V2247A probably damaging Het
Tg C T 15: 66,773,398 R2385C probably damaging Het
Tomm70a G T 16: 57,121,967 A36S unknown Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Unc45b A G 11: 82,933,888 I629M possibly damaging Het
Vmn1r16 T C 6: 57,323,439 E66G noncoding transcript Het
Vmn1r189 C T 13: 22,102,131 V179I probably benign Het
Vmn2r105 T G 17: 20,228,513 E134A probably benign Het
Wdr70 G A 15: 7,887,370 A522V probably benign Het
Zcchc11 A G 4: 108,512,150 I636V probably benign Het
Zfp184 T A 13: 21,958,825 C234S probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Polr3f
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0243:Polr3f UTSW 2 144536275 unclassified probably benign
R0761:Polr3f UTSW 2 144534407 missense probably damaging 1.00
R1307:Polr3f UTSW 2 144533193 missense probably damaging 1.00
R1340:Polr3f UTSW 2 144538628 missense probably benign 0.01
R1992:Polr3f UTSW 2 144536310 missense probably benign 0.00
R4817:Polr3f UTSW 2 144534081 makesense probably null
R6037:Polr3f UTSW 2 144536023 missense probably damaging 0.98
R6037:Polr3f UTSW 2 144536023 missense probably damaging 0.98
R6291:Polr3f UTSW 2 144534388 missense probably damaging 1.00
R8546:Polr3f UTSW 2 144532364 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAAATTCCTACAAAGCAAGGTGAG -3'
(R):5'- TTCAGCAGGATGTGTGCCTG -3'

Sequencing Primer
(F):5'- GTGAGGTCATTAAGGAAACATCAC -3'
(R):5'- CAGGATGTGTGCCTGGAAGG -3'
Posted On2020-07-13