Incidental Mutation 'R8214:Abhd16b'
ID636301
Institutional Source Beutler Lab
Gene Symbol Abhd16b
Ensembl Gene ENSMUSG00000055882
Gene Nameabhydrolase domain containing 16B
SynonymsBC050777
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R8214 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location181493206-181494980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 181494190 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 295 (T295I)
Ref Sequence ENSEMBL: ENSMUSP00000066520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000844] [ENSMUST00000069649] [ENSMUST00000069712] [ENSMUST00000108799] [ENSMUST00000108800] [ENSMUST00000149163] [ENSMUST00000184588] [ENSMUST00000184849]
Predicted Effect probably benign
Transcript: ENSMUST00000000844
SMART Domains Protein: ENSMUSP00000000844
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 28 199 6.2e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000069649
AA Change: T295I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066520
Gene: ENSMUSG00000055882
AA Change: T295I

DomainStartEndE-ValueType
Pfam:Abhydrolase_1 174 339 2.9e-11 PFAM
Pfam:Abhydrolase_5 174 341 2.1e-13 PFAM
Pfam:Hydrolase_4 180 308 5.1e-9 PFAM
low complexity region 345 357 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069712
SMART Domains Protein: ENSMUSP00000068888
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 27 193 5.8e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108799
SMART Domains Protein: ENSMUSP00000104427
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 18 121 1.9e-38 PFAM
Pfam:TPD52 115 220 1.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108800
SMART Domains Protein: ENSMUSP00000104428
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 27 179 2.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149163
SMART Domains Protein: ENSMUSP00000117690
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 28 213 5.2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184588
Predicted Effect probably benign
Transcript: ENSMUST00000184849
SMART Domains Protein: ENSMUSP00000138837
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 9 170 2.4e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,286,621 R52Q Het
Abcc3 C T 11: 94,363,518 R718H probably damaging Het
Abcc4 T C 14: 118,500,841 M1166V probably benign Het
Amph A G 13: 19,104,298 N319S possibly damaging Het
Ankrd27 A G 7: 35,614,519 D425G probably damaging Het
Atg4b T C 1: 93,784,887 S316P probably damaging Het
Brd4 A G 17: 32,212,947 S649P probably benign Het
Bzw1 T C 1: 58,405,037 S411P probably damaging Het
Dnah6 T C 6: 73,044,728 D3537G probably damaging Het
Dnpep A T 1: 75,315,998 W126R probably damaging Het
Efcab2 T C 1: 178,437,450 V27A probably benign Het
Kctd21 T C 7: 97,347,341 L7P probably damaging Het
Kidins220 C T 12: 24,994,855 T216I probably damaging Het
Lpl T A 8: 68,892,605 M87K probably damaging Het
Lrrc16a T C 13: 24,044,232 E987G probably damaging Het
Ltn1 A G 16: 87,380,803 V1646A probably benign Het
Madcam1 A G 10: 79,666,758 T359A probably benign Het
Muc5ac A G 7: 141,802,948 K1092E possibly damaging Het
Nrg2 T C 18: 36,196,676 E162G probably benign Het
Olfr1333 A T 4: 118,830,091 F117L probably benign Het
Olfr474 T A 7: 107,954,967 S109T probably benign Het
Olfr589 A C 7: 103,155,406 S114A probably damaging Het
Pcdhb5 G T 18: 37,321,583 V339L probably benign Het
Plec A G 15: 76,192,284 W145R unknown Het
Polr3f A G 2: 144,536,310 N201D probably benign Het
Skint5 T C 4: 113,804,942 probably null Het
Slc12a2 A G 18: 57,937,719 I1048V probably benign Het
Sult2a4 A G 7: 13,989,476 I39T probably benign Het
Tenm4 T C 7: 96,895,407 V2247A probably damaging Het
Tg C T 15: 66,773,398 R2385C probably damaging Het
Tomm70a G T 16: 57,121,967 A36S unknown Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Unc45b A G 11: 82,933,888 I629M possibly damaging Het
Vmn1r16 T C 6: 57,323,439 E66G noncoding transcript Het
Vmn1r189 C T 13: 22,102,131 V179I probably benign Het
Vmn2r105 T G 17: 20,228,513 E134A probably benign Het
Wdr70 G A 15: 7,887,370 A522V probably benign Het
Zcchc11 A G 4: 108,512,150 I636V probably benign Het
Zfp184 T A 13: 21,958,825 C234S probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Abhd16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01651:Abhd16b APN 2 181494738 unclassified probably benign
IGL02237:Abhd16b APN 2 181493557 missense probably benign 0.00
IGL02457:Abhd16b APN 2 181494334 missense probably benign 0.00
PIT4486001:Abhd16b UTSW 2 181493959 missense probably benign 0.39
R1760:Abhd16b UTSW 2 181493404 missense probably damaging 1.00
R2077:Abhd16b UTSW 2 181493416 missense probably benign 0.44
R3124:Abhd16b UTSW 2 181494526 missense possibly damaging 0.70
R4779:Abhd16b UTSW 2 181493460 missense possibly damaging 0.59
R5781:Abhd16b UTSW 2 181494154 missense probably damaging 1.00
R6220:Abhd16b UTSW 2 181493785 missense probably damaging 1.00
R6994:Abhd16b UTSW 2 181493668 missense possibly damaging 0.94
R7305:Abhd16b UTSW 2 181493416 missense possibly damaging 0.85
R7850:Abhd16b UTSW 2 181493725 missense not run
R8115:Abhd16b UTSW 2 181493734 missense possibly damaging 0.55
R8132:Abhd16b UTSW 2 181493967 missense probably damaging 1.00
R8782:Abhd16b UTSW 2 181494415 missense probably benign
X0052:Abhd16b UTSW 2 181494265 missense probably damaging 1.00
X0066:Abhd16b UTSW 2 181493713 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TCAAATATGCGCTGCACCG -3'
(R):5'- TATCTGTGCTGTAGAAGGCG -3'

Sequencing Primer
(F):5'- ATATGCGCTGCACCGTTTGAAC -3'
(R):5'- GCGCAACAGCAGCTCATTG -3'
Posted On2020-07-13