Mutagenetix > Incidental Mutation

Incidental Mutation 'R8214:Zcchc11'

636302

Institutional Source

Beutler Lab

Gene Symbol

Zcchc11

Ensembl Gene

ENSMUSG00000034610

Gene Name

zinc finger, CCHC domain containing 11

Synonyms

6030404K05Rik, 9230115F04Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8214 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

108459426-108559421 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108512150 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 636 (I636V)

Ref Sequence

ENSEMBL: ENSMUSP00000120172 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043368] [ENSMUST00000097925] [ENSMUST00000155068]

AlphaFold

B2RX14

Predicted Effect

probably benign
Transcript: ENSMUST00000043368
AA Change: I675V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000044836
Gene: ENSMUSG00000034610
AA Change: I675V

Domain	Start	End	E-Value	Type
low complexity region	260	275	N/A	INTRINSIC
SCOP:d1f5aa2	363	569	2e-23	SMART
Pfam:PAP_assoc	648	701	1.2e-13	PFAM
low complexity region	743	758	N/A	INTRINSIC
low complexity region	815	828	N/A	INTRINSIC
ZnF_C2HC	931	947	7.79e-3	SMART
Pfam:NTP_transf_2	995	1085	4.2e-10	PFAM
Pfam:PAP_assoc	1201	1254	4.7e-19	PFAM
ZnF_C2HC	1311	1327	3.83e-3	SMART
ZnF_C2HC	1359	1375	3.44e-4	SMART
low complexity region	1398	1412	N/A	INTRINSIC
low complexity region	1418	1473	N/A	INTRINSIC
low complexity region	1628	1639	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000097925
AA Change: I675V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000095538
Gene: ENSMUSG00000034610
AA Change: I675V

Domain	Start	End	E-Value	Type
low complexity region	260	275	N/A	INTRINSIC
SCOP:d1f5aa2	363	569	2e-23	SMART
Pfam:PAP_assoc	648	701	8e-14	PFAM
low complexity region	743	758	N/A	INTRINSIC
low complexity region	815	828	N/A	INTRINSIC
ZnF_C2HC	931	947	7.79e-3	SMART
Pfam:NTP_transf_2	994	1082	6.3e-11	PFAM
Pfam:PAP_assoc	1201	1254	5.2e-19	PFAM
ZnF_C2HC	1311	1327	3.83e-3	SMART
ZnF_C2HC	1364	1380	3.44e-4	SMART
low complexity region	1403	1417	N/A	INTRINSIC
low complexity region	1423	1478	N/A	INTRINSIC
low complexity region	1632	1643	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000155068
AA Change: I636V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000120172
Gene: ENSMUSG00000034610
AA Change: I636V

Domain	Start	End	E-Value	Type
low complexity region	221	236	N/A	INTRINSIC
SCOP:d1f5aa2	324	530	2e-23	SMART
Pfam:PAP_assoc	609	662	8.8e-15	PFAM
low complexity region	704	719	N/A	INTRINSIC
low complexity region	776	789	N/A	INTRINSIC
ZnF_C2HC	892	908	7.79e-3	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ZCCHC11 is an RNA uridyltransferase (EC 2.7.7.52) that uses UTP to add uridines to the 3-prime end of substrate RNA molecules (Jones et al., 2009 [PubMed 19701194]).[supplied by OMIM, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial postnatal lethality associated with postnatal growth retardation and reduced circulating insulin-like growth factor I levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930438A08Rik	G	A	11: 58,286,621	R52Q		Het
Abcc3	C	T	11: 94,363,518	R718H	probably damaging	Het
Abcc4	T	C	14: 118,500,841	M1166V	probably benign	Het
Abhd16b	C	T	2: 181,494,190	T295I	probably damaging	Het
Amph	A	G	13: 19,104,298	N319S	possibly damaging	Het
Ankrd27	A	G	7: 35,614,519	D425G	probably damaging	Het
Atg4b	T	C	1: 93,784,887	S316P	probably damaging	Het
Brd4	A	G	17: 32,212,947	S649P	probably benign	Het
Bzw1	T	C	1: 58,405,037	S411P	probably damaging	Het
Dnah6	T	C	6: 73,044,728	D3537G	probably damaging	Het
Dnpep	A	T	1: 75,315,998	W126R	probably damaging	Het
Efcab2	T	C	1: 178,437,450	V27A	probably benign	Het
Kctd21	T	C	7: 97,347,341	L7P	probably damaging	Het
Kidins220	C	T	12: 24,994,855	T216I	probably damaging	Het
Lpl	T	A	8: 68,892,605	M87K	probably damaging	Het
Lrrc16a	T	C	13: 24,044,232	E987G	probably damaging	Het
Ltn1	A	G	16: 87,380,803	V1646A	probably benign	Het
Madcam1	A	G	10: 79,666,758	T359A	probably benign	Het
Muc5ac	A	G	7: 141,802,948	K1092E	possibly damaging	Het
Nrg2	T	C	18: 36,196,676	E162G	probably benign	Het
Olfr1333	A	T	4: 118,830,091	F117L	probably benign	Het
Olfr474	T	A	7: 107,954,967	S109T	probably benign	Het
Olfr589	A	C	7: 103,155,406	S114A	probably damaging	Het
Pcdhb5	G	T	18: 37,321,583	V339L	probably benign	Het
Plec	A	G	15: 76,192,284	W145R	unknown	Het
Polr3f	A	G	2: 144,536,310	N201D	probably benign	Het
Skint5	T	C	4: 113,804,942		probably null	Het
Slc12a2	A	G	18: 57,937,719	I1048V	probably benign	Het
Sult2a4	A	G	7: 13,989,476	I39T	probably benign	Het
Tenm4	T	C	7: 96,895,407	V2247A	probably damaging	Het
Tg	C	T	15: 66,773,398	R2385C	probably damaging	Het
Tomm70a	G	T	16: 57,121,967	A36S	unknown	Het
Top2b	G	A	14: 16,383,177	R55H	probably damaging	Het
Unc45b	A	G	11: 82,933,888	I629M	possibly damaging	Het
Vmn1r16	T	C	6: 57,323,439	E66G	noncoding transcript	Het
Vmn1r189	C	T	13: 22,102,131	V179I	probably benign	Het
Vmn2r105	T	G	17: 20,228,513	E134A	probably benign	Het
Wdr70	G	A	15: 7,887,370	A522V	probably benign	Het
Zfp184	T	A	13: 21,958,825	C234S	probably damaging	Het
Zscan5b	C	T	7: 6,233,947	P232S	possibly damaging	Het

Other mutations in Zcchc11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Zcchc11	APN	4	108550728	missense	probably damaging	1.00
IGL00684:Zcchc11	APN	4	108479466	missense	possibly damaging	0.80
IGL01598:Zcchc11	APN	4	108550820	unclassified	probably benign
IGL01599:Zcchc11	APN	4	108513399	missense	possibly damaging	0.85
IGL02088:Zcchc11	APN	4	108512218	splice site	probably benign
IGL02451:Zcchc11	APN	4	108529276	nonsense	probably null
IGL02667:Zcchc11	APN	4	108558708	splice site	probably benign
IGL03080:Zcchc11	APN	4	108505824	missense	probably damaging	1.00
IGL03374:Zcchc11	APN	4	108558777	missense	probably damaging	1.00
Flatter	UTSW	4	108542711	critical splice donor site	probably null
Ingratiate	UTSW	4	108512195	missense	probably damaging	1.00
oedipus	UTSW	4	108549355	missense	probably damaging	1.00
Please	UTSW	4	108512886	nonsense	probably null
H8786:Zcchc11	UTSW	4	108550815	critical splice donor site	probably null
IGL02799:Zcchc11	UTSW	4	108513528	missense	probably benign
R0013:Zcchc11	UTSW	4	108530955	splice site	probably benign
R0013:Zcchc11	UTSW	4	108530955	splice site	probably benign
R0051:Zcchc11	UTSW	4	108527004	missense	probably damaging	1.00
R0051:Zcchc11	UTSW	4	108527004	missense	probably damaging	1.00
R0410:Zcchc11	UTSW	4	108486555	missense	probably benign	0.27
R0698:Zcchc11	UTSW	4	108555533	missense	probably benign	0.22
R0745:Zcchc11	UTSW	4	108502955	splice site	probably benign
R1080:Zcchc11	UTSW	4	108479499	missense	possibly damaging	0.82
R1774:Zcchc11	UTSW	4	108507955	missense	probably damaging	1.00
R1809:Zcchc11	UTSW	4	108549355	missense	probably damaging	1.00
R1869:Zcchc11	UTSW	4	108529300	missense	probably damaging	1.00
R1874:Zcchc11	UTSW	4	108550725	missense	probably damaging	1.00
R1958:Zcchc11	UTSW	4	108555706	missense	probably damaging	1.00
R1976:Zcchc11	UTSW	4	108479523	missense	probably benign	0.01
R2034:Zcchc11	UTSW	4	108512195	missense	probably damaging	1.00
R2164:Zcchc11	UTSW	4	108503029	missense	possibly damaging	0.73
R2251:Zcchc11	UTSW	4	108520208	missense	probably damaging	1.00
R3001:Zcchc11	UTSW	4	108512928	missense	probably damaging	1.00
R3002:Zcchc11	UTSW	4	108512928	missense	probably damaging	1.00
R3003:Zcchc11	UTSW	4	108512928	missense	probably damaging	1.00
R4170:Zcchc11	UTSW	4	108548059	missense	probably damaging	1.00
R4667:Zcchc11	UTSW	4	108495159	missense	probably damaging	1.00
R4868:Zcchc11	UTSW	4	108549220	splice site	probably benign
R4989:Zcchc11	UTSW	4	108526845	unclassified	probably benign
R5014:Zcchc11	UTSW	4	108526846	unclassified	probably benign
R5118:Zcchc11	UTSW	4	108520292	missense	possibly damaging	0.92
R5431:Zcchc11	UTSW	4	108491412	missense	probably damaging	1.00
R5645:Zcchc11	UTSW	4	108557373	missense	probably damaging	1.00
R5661:Zcchc11	UTSW	4	108513187	missense	probably benign	0.05
R5877:Zcchc11	UTSW	4	108512923	missense	probably damaging	0.99
R6307:Zcchc11	UTSW	4	108555620	missense	probably damaging	1.00
R6326:Zcchc11	UTSW	4	108478980	missense	probably benign	0.02
R6407:Zcchc11	UTSW	4	108558782	missense	probably damaging	1.00
R6493:Zcchc11	UTSW	4	108526805	missense	probably damaging	1.00
R6587:Zcchc11	UTSW	4	108479449	missense	probably benign
R7215:Zcchc11	UTSW	4	108527008	missense	probably damaging	1.00
R7413:Zcchc11	UTSW	4	108549336	missense	possibly damaging	0.69
R7584:Zcchc11	UTSW	4	108479346	missense	probably benign	0.00
R7872:Zcchc11	UTSW	4	108517518	missense	probably damaging	1.00
R7970:Zcchc11	UTSW	4	108486454	missense	probably benign	0.00
R8297:Zcchc11	UTSW	4	108479708	missense	possibly damaging	0.86
R8504:Zcchc11	UTSW	4	108530942	missense	probably damaging	1.00
R8514:Zcchc11	UTSW	4	108557357	missense	possibly damaging	0.65
R8557:Zcchc11	UTSW	4	108542711	critical splice donor site	probably null
R8750:Zcchc11	UTSW	4	108550743	missense	probably damaging	1.00
R8805:Zcchc11	UTSW	4	108549378	missense	possibly damaging	0.83
R8903:Zcchc11	UTSW	4	108479211	missense	probably damaging	1.00
R9003:Zcchc11	UTSW	4	108542832	missense	probably damaging	0.98
R9218:Zcchc11	UTSW	4	108512886	nonsense	probably null
R9412:Zcchc11	UTSW	4	108557364	missense
R9546:Zcchc11	UTSW	4	108513232	missense	probably benign	0.05
R9547:Zcchc11	UTSW	4	108513232	missense	probably benign	0.05
R9721:Zcchc11	UTSW	4	108555581	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- AAGTGCTTTCTTTATGCCTGAC -3'
(R):5'- AAGTTGATGTGAAACCCAGTCAAC -3'

Sequencing Primer
(F):5'- GGAAGCACCAAATCAGGTA -3'
(R):5'- CCAGTCAACATCAATCATCATTGTC -3'

Posted On

2020-07-13