Incidental Mutation 'R8214:Olfr1333'
ID636303
Institutional Source Beutler Lab
Gene Symbol Olfr1333
Ensembl Gene ENSMUSG00000110947
Gene Nameolfactory receptor 1333
SynonymsMOR259-11, GA_x6K02T2QD9B-18703033-18703986, MOR259-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R8214 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location118827659-118836279 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118830091 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 117 (F117L)
Ref Sequence ENSEMBL: ENSMUSP00000101968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076019] [ENSMUST00000106361]
Predicted Effect probably benign
Transcript: ENSMUST00000076019
AA Change: F116L

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000075398
Gene: ENSMUSG00000110947
AA Change: F116L

DomainStartEndE-ValueType
Pfam:7tm_1 42 291 4.1e-31 PFAM
Pfam:7tm_4 140 284 2.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106361
AA Change: F117L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101968
Gene: ENSMUSG00000073768
AA Change: F117L

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 6.1e-56 PFAM
Pfam:7tm_1 43 292 3.9e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,286,621 R52Q Het
Abcc3 C T 11: 94,363,518 R718H probably damaging Het
Abcc4 T C 14: 118,500,841 M1166V probably benign Het
Abhd16b C T 2: 181,494,190 T295I probably damaging Het
Amph A G 13: 19,104,298 N319S possibly damaging Het
Ankrd27 A G 7: 35,614,519 D425G probably damaging Het
Atg4b T C 1: 93,784,887 S316P probably damaging Het
Brd4 A G 17: 32,212,947 S649P probably benign Het
Bzw1 T C 1: 58,405,037 S411P probably damaging Het
Dnah6 T C 6: 73,044,728 D3537G probably damaging Het
Dnpep A T 1: 75,315,998 W126R probably damaging Het
Efcab2 T C 1: 178,437,450 V27A probably benign Het
Kctd21 T C 7: 97,347,341 L7P probably damaging Het
Kidins220 C T 12: 24,994,855 T216I probably damaging Het
Lpl T A 8: 68,892,605 M87K probably damaging Het
Lrrc16a T C 13: 24,044,232 E987G probably damaging Het
Ltn1 A G 16: 87,380,803 V1646A probably benign Het
Madcam1 A G 10: 79,666,758 T359A probably benign Het
Muc5ac A G 7: 141,802,948 K1092E possibly damaging Het
Nrg2 T C 18: 36,196,676 E162G probably benign Het
Olfr474 T A 7: 107,954,967 S109T probably benign Het
Olfr589 A C 7: 103,155,406 S114A probably damaging Het
Pcdhb5 G T 18: 37,321,583 V339L probably benign Het
Plec A G 15: 76,192,284 W145R unknown Het
Polr3f A G 2: 144,536,310 N201D probably benign Het
Skint5 T C 4: 113,804,942 probably null Het
Slc12a2 A G 18: 57,937,719 I1048V probably benign Het
Sult2a4 A G 7: 13,989,476 I39T probably benign Het
Tenm4 T C 7: 96,895,407 V2247A probably damaging Het
Tg C T 15: 66,773,398 R2385C probably damaging Het
Tomm70a G T 16: 57,121,967 A36S unknown Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Unc45b A G 11: 82,933,888 I629M possibly damaging Het
Vmn1r16 T C 6: 57,323,439 E66G noncoding transcript Het
Vmn1r189 C T 13: 22,102,131 V179I probably benign Het
Vmn2r105 T G 17: 20,228,513 E134A probably benign Het
Wdr70 G A 15: 7,887,370 A522V probably benign Het
Zcchc11 A G 4: 108,512,150 I636V probably benign Het
Zfp184 T A 13: 21,958,825 C234S probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Olfr1333
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Olfr1333 APN 4 118829792 missense probably benign 0.30
IGL03023:Olfr1333 APN 4 118830252 missense probably damaging 0.99
IGL03387:Olfr1333 APN 4 118830041 missense probably damaging 1.00
R0326:Olfr1333 UTSW 4 118829825 missense possibly damaging 0.90
R0532:Olfr1333 UTSW 4 118829700 missense probably damaging 1.00
R1775:Olfr1333 UTSW 4 118829868 missense probably benign 0.00
R1906:Olfr1333 UTSW 4 118830270 missense probably damaging 1.00
R1946:Olfr1333 UTSW 4 118830026 missense probably benign 0.00
R2260:Olfr1333 UTSW 4 118830162 missense probably damaging 1.00
R5084:Olfr1333 UTSW 4 118829570 missense probably damaging 1.00
R5337:Olfr1333 UTSW 4 118829666 missense probably benign 0.44
R5444:Olfr1333 UTSW 4 118830111 missense probably benign
R5817:Olfr1333 UTSW 4 118830099 missense probably damaging 0.96
R5973:Olfr1333 UTSW 4 118830216 missense probably benign 0.22
R5987:Olfr1333 UTSW 4 118830281 missense probably damaging 0.96
R6031:Olfr1333 UTSW 4 118830391 splice site probably null
R6031:Olfr1333 UTSW 4 118830391 splice site probably null
R7255:Olfr1333 UTSW 4 118829952 missense probably benign 0.17
R7483:Olfr1333 UTSW 4 118830320 missense probably damaging 0.98
Z1176:Olfr1333 UTSW 4 118830050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTACGCACTGAAGGAC -3'
(R):5'- AGCTGCACACTCCCATGTAC -3'

Sequencing Primer
(F):5'- CACAAGTAGTGGTTGACCCTG -3'
(R):5'- GCACACTCCCATGTACTTCTTC -3'
Posted On2020-07-13