Incidental Mutation 'R8214:Or10ak11'
ID 636303
Institutional Source Beutler Lab
Gene Symbol Or10ak11
Ensembl Gene ENSMUSG00000110947
Gene Name olfactory receptor family 10 subfamily AK member 11
Synonyms Olfr1333, MOR259-6, MOR259-11, GA_x6K02T2QD9B-18703033-18703986
MMRRC Submission 067656-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R8214 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 118686682-118687635 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 118687288 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 117 (F117L)
Ref Sequence ENSEMBL: ENSMUSP00000101968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076019] [ENSMUST00000106361]
AlphaFold Q7TQV7
Predicted Effect probably benign
Transcript: ENSMUST00000076019
AA Change: F116L

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000075398
Gene: ENSMUSG00000110947
AA Change: F116L

DomainStartEndE-ValueType
Pfam:7tm_1 42 291 4.1e-31 PFAM
Pfam:7tm_4 140 284 2.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106361
AA Change: F117L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101968
Gene: ENSMUSG00000073768
AA Change: F117L

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 6.1e-56 PFAM
Pfam:7tm_1 43 292 3.9e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,177,447 (GRCm39) R52Q Het
Abcc3 C T 11: 94,254,344 (GRCm39) R718H probably damaging Het
Abcc4 T C 14: 118,738,253 (GRCm39) M1166V probably benign Het
Abhd16b C T 2: 181,135,983 (GRCm39) T295I probably damaging Het
Amph A G 13: 19,288,468 (GRCm39) N319S possibly damaging Het
Ankrd27 A G 7: 35,313,944 (GRCm39) D425G probably damaging Het
Atg4b T C 1: 93,712,609 (GRCm39) S316P probably damaging Het
Brd4 A G 17: 32,431,921 (GRCm39) S649P probably benign Het
Bzw1 T C 1: 58,444,196 (GRCm39) S411P probably damaging Het
Carmil1 T C 13: 24,228,215 (GRCm39) E987G probably damaging Het
Dnah6 T C 6: 73,021,711 (GRCm39) D3537G probably damaging Het
Dnpep A T 1: 75,292,642 (GRCm39) W126R probably damaging Het
Efcab2 T C 1: 178,265,015 (GRCm39) V27A probably benign Het
Kctd21 T C 7: 96,996,548 (GRCm39) L7P probably damaging Het
Kidins220 C T 12: 25,044,854 (GRCm39) T216I probably damaging Het
Lpl T A 8: 69,345,257 (GRCm39) M87K probably damaging Het
Ltn1 A G 16: 87,177,691 (GRCm39) V1646A probably benign Het
Madcam1 A G 10: 79,502,592 (GRCm39) T359A probably benign Het
Muc5ac A G 7: 141,356,685 (GRCm39) K1092E possibly damaging Het
Nrg2 T C 18: 36,329,729 (GRCm39) E162G probably benign Het
Or52e2 A C 7: 102,804,613 (GRCm39) S114A probably damaging Het
Or5p54 T A 7: 107,554,174 (GRCm39) S109T probably benign Het
Pcdhb5 G T 18: 37,454,636 (GRCm39) V339L probably benign Het
Plec A G 15: 76,076,484 (GRCm39) W145R unknown Het
Polr3f A G 2: 144,378,230 (GRCm39) N201D probably benign Het
Skint5 T C 4: 113,662,139 (GRCm39) probably null Het
Slc12a2 A G 18: 58,070,791 (GRCm39) I1048V probably benign Het
Sult2a4 A G 7: 13,723,401 (GRCm39) I39T probably benign Het
Tenm4 T C 7: 96,544,614 (GRCm39) V2247A probably damaging Het
Tg C T 15: 66,645,247 (GRCm39) R2385C probably damaging Het
Tomm70a G T 16: 56,942,330 (GRCm39) A36S unknown Het
Top2b G A 14: 16,383,177 (GRCm38) R55H probably damaging Het
Tut4 A G 4: 108,369,347 (GRCm39) I636V probably benign Het
Unc45b A G 11: 82,824,714 (GRCm39) I629M possibly damaging Het
Vmn1r16 T C 6: 57,300,424 (GRCm39) E66G noncoding transcript Het
Vmn1r189 C T 13: 22,286,301 (GRCm39) V179I probably benign Het
Vmn2r105 T G 17: 20,448,775 (GRCm39) E134A probably benign Het
Wdr70 G A 15: 7,916,851 (GRCm39) A522V probably benign Het
Zfp184 T A 13: 22,142,995 (GRCm39) C234S probably damaging Het
Zscan5b C T 7: 6,236,946 (GRCm39) P232S possibly damaging Het
Other mutations in Or10ak11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Or10ak11 APN 4 118,686,989 (GRCm39) missense probably benign 0.30
IGL03023:Or10ak11 APN 4 118,687,449 (GRCm39) missense probably damaging 0.99
IGL03387:Or10ak11 APN 4 118,687,238 (GRCm39) missense probably damaging 1.00
R0326:Or10ak11 UTSW 4 118,687,022 (GRCm39) missense possibly damaging 0.90
R0532:Or10ak11 UTSW 4 118,686,897 (GRCm39) missense probably damaging 1.00
R1775:Or10ak11 UTSW 4 118,687,065 (GRCm39) missense probably benign 0.00
R1906:Or10ak11 UTSW 4 118,687,467 (GRCm39) missense probably damaging 1.00
R1946:Or10ak11 UTSW 4 118,687,223 (GRCm39) missense probably benign 0.00
R2260:Or10ak11 UTSW 4 118,687,359 (GRCm39) missense probably damaging 1.00
R5084:Or10ak11 UTSW 4 118,686,767 (GRCm39) missense probably damaging 1.00
R5337:Or10ak11 UTSW 4 118,686,863 (GRCm39) missense probably benign 0.44
R5444:Or10ak11 UTSW 4 118,687,308 (GRCm39) missense probably benign
R5817:Or10ak11 UTSW 4 118,687,296 (GRCm39) missense probably damaging 0.96
R5973:Or10ak11 UTSW 4 118,687,413 (GRCm39) missense probably benign 0.22
R5987:Or10ak11 UTSW 4 118,687,478 (GRCm39) missense probably damaging 0.96
R6031:Or10ak11 UTSW 4 118,687,588 (GRCm39) splice site probably null
R6031:Or10ak11 UTSW 4 118,687,588 (GRCm39) splice site probably null
R7255:Or10ak11 UTSW 4 118,687,149 (GRCm39) missense probably benign 0.17
R7483:Or10ak11 UTSW 4 118,687,517 (GRCm39) missense probably damaging 0.98
R8479:Or10ak11 UTSW 4 118,687,212 (GRCm39) missense probably damaging 1.00
R8847:Or10ak11 UTSW 4 118,686,821 (GRCm39) missense probably damaging 0.97
R9661:Or10ak11 UTSW 4 118,687,526 (GRCm39) missense probably benign 0.45
Z1176:Or10ak11 UTSW 4 118,687,247 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTACGCACTGAAGGAC -3'
(R):5'- AGCTGCACACTCCCATGTAC -3'

Sequencing Primer
(F):5'- CACAAGTAGTGGTTGACCCTG -3'
(R):5'- GCACACTCCCATGTACTTCTTC -3'
Posted On 2020-07-13