Incidental Mutation 'R8214:Zscan5b'
ID636306
Institutional Source Beutler Lab
Gene Symbol Zscan5b
Ensembl Gene ENSMUSG00000058028
Gene Namezinc finger and SCAN domain containing 5B
SynonymsZfg1, Zfp371
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8214 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location6222278-6239423 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6233947 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 232 (P232S)
Ref Sequence ENSEMBL: ENSMUSP00000072449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072662] [ENSMUST00000155314] [ENSMUST00000165445]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072662
AA Change: P232S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072449
Gene: ENSMUSG00000058028
AA Change: P232S

DomainStartEndE-ValueType
Pfam:SCAN 31 121 1.6e-25 PFAM
low complexity region 157 166 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
ZnF_C2H2 326 348 3.11e-2 SMART
ZnF_C2H2 354 376 1.28e-3 SMART
ZnF_C2H2 382 404 1.36e-2 SMART
ZnF_C2H2 410 432 3.16e-3 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155314
SMART Domains Protein: ENSMUSP00000118508
Gene: ENSMUSG00000058028

DomainStartEndE-ValueType
Pfam:SCAN 31 121 4.1e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165445
AA Change: P232S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126044
Gene: ENSMUSG00000058028
AA Change: P232S

DomainStartEndE-ValueType
Pfam:SCAN 33 120 1e-25 PFAM
low complexity region 157 166 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
ZnF_C2H2 326 348 3.11e-2 SMART
ZnF_C2H2 354 376 1.28e-3 SMART
ZnF_C2H2 382 404 1.36e-2 SMART
ZnF_C2H2 410 432 3.16e-3 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,286,621 R52Q Het
Abcc3 C T 11: 94,363,518 R718H probably damaging Het
Abcc4 T C 14: 118,500,841 M1166V probably benign Het
Abhd16b C T 2: 181,494,190 T295I probably damaging Het
Amph A G 13: 19,104,298 N319S possibly damaging Het
Ankrd27 A G 7: 35,614,519 D425G probably damaging Het
Atg4b T C 1: 93,784,887 S316P probably damaging Het
Brd4 A G 17: 32,212,947 S649P probably benign Het
Bzw1 T C 1: 58,405,037 S411P probably damaging Het
Dnah6 T C 6: 73,044,728 D3537G probably damaging Het
Dnpep A T 1: 75,315,998 W126R probably damaging Het
Efcab2 T C 1: 178,437,450 V27A probably benign Het
Kctd21 T C 7: 97,347,341 L7P probably damaging Het
Kidins220 C T 12: 24,994,855 T216I probably damaging Het
Lpl T A 8: 68,892,605 M87K probably damaging Het
Lrrc16a T C 13: 24,044,232 E987G probably damaging Het
Ltn1 A G 16: 87,380,803 V1646A probably benign Het
Madcam1 A G 10: 79,666,758 T359A probably benign Het
Muc5ac A G 7: 141,802,948 K1092E possibly damaging Het
Nrg2 T C 18: 36,196,676 E162G probably benign Het
Olfr1333 A T 4: 118,830,091 F117L probably benign Het
Olfr474 T A 7: 107,954,967 S109T probably benign Het
Olfr589 A C 7: 103,155,406 S114A probably damaging Het
Pcdhb5 G T 18: 37,321,583 V339L probably benign Het
Plec A G 15: 76,192,284 W145R unknown Het
Polr3f A G 2: 144,536,310 N201D probably benign Het
Skint5 T C 4: 113,804,942 probably null Het
Slc12a2 A G 18: 57,937,719 I1048V probably benign Het
Sult2a4 A G 7: 13,989,476 I39T probably benign Het
Tenm4 T C 7: 96,895,407 V2247A probably damaging Het
Tg C T 15: 66,773,398 R2385C probably damaging Het
Tomm70a G T 16: 57,121,967 A36S unknown Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Unc45b A G 11: 82,933,888 I629M possibly damaging Het
Vmn1r16 T C 6: 57,323,439 E66G noncoding transcript Het
Vmn1r189 C T 13: 22,102,131 V179I probably benign Het
Vmn2r105 T G 17: 20,228,513 E134A probably benign Het
Wdr70 G A 15: 7,887,370 A522V probably benign Het
Zcchc11 A G 4: 108,512,150 I636V probably benign Het
Zfp184 T A 13: 21,958,825 C234S probably damaging Het
Other mutations in Zscan5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Zscan5b APN 7 6231422 missense probably benign 0.00
R0505:Zscan5b UTSW 7 6239075 missense probably damaging 0.99
R0535:Zscan5b UTSW 7 6233912 missense possibly damaging 0.72
R1401:Zscan5b UTSW 7 6230426 missense probably damaging 1.00
R1537:Zscan5b UTSW 7 6233851 missense probably benign 0.00
R1613:Zscan5b UTSW 7 6230375 missense probably damaging 1.00
R1820:Zscan5b UTSW 7 6239163 missense probably damaging 1.00
R1833:Zscan5b UTSW 7 6238966 missense possibly damaging 0.67
R2191:Zscan5b UTSW 7 6231443 missense possibly damaging 0.53
R3177:Zscan5b UTSW 7 6231346 missense possibly damaging 0.86
R3277:Zscan5b UTSW 7 6231346 missense possibly damaging 0.86
R4911:Zscan5b UTSW 7 6239190 makesense probably null
R5624:Zscan5b UTSW 7 6230519 missense probably benign 0.00
R8213:Zscan5b UTSW 7 6233947 missense possibly damaging 0.93
R8326:Zscan5b UTSW 7 6233947 missense possibly damaging 0.93
R8327:Zscan5b UTSW 7 6233947 missense possibly damaging 0.93
R8328:Zscan5b UTSW 7 6233947 missense possibly damaging 0.93
X0018:Zscan5b UTSW 7 6230276 missense probably damaging 0.97
X0024:Zscan5b UTSW 7 6238949 missense probably benign 0.00
X0025:Zscan5b UTSW 7 6238615 missense probably benign 0.18
Z1177:Zscan5b UTSW 7 6230217 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAAGTGAGTGTAGTGCGCCG -3'
(R):5'- CTGCAATTCGGGTATAAAGTGAAC -3'

Sequencing Primer
(F):5'- GCCGATCCAGACAGCTTTCTG -3'
(R):5'- TCAACTCTGGTGTTGGCT -3'
Posted On2020-07-13