Incidental Mutation 'R8214:Sult2a4'
ID636307
Institutional Source Beutler Lab
Gene Symbol Sult2a4
Ensembl Gene ENSMUSG00000074377
Gene Namesulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 4
SynonymsGm5584
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R8214 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location13909676-13989607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13989476 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 39 (I39T)
Ref Sequence ENSEMBL: ENSMUSP00000104160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108520] [ENSMUST00000165167]
Predicted Effect probably benign
Transcript: ENSMUST00000108520
AA Change: I39T

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104160
Gene: ENSMUSG00000074377
AA Change: I39T

DomainStartEndE-ValueType
Pfam:Sulfotransfer_3 5 205 1.5e-10 PFAM
Pfam:Sulfotransfer_1 34 278 1.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165167
AA Change: I38T

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130490
Gene: ENSMUSG00000074377
AA Change: I38T

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 33 277 1.3e-82 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: This is one of seven sulfotransferase family 2A genes in a chromosome 7 A1 cluster. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,286,621 R52Q Het
Abcc3 C T 11: 94,363,518 R718H probably damaging Het
Abcc4 T C 14: 118,500,841 M1166V probably benign Het
Abhd16b C T 2: 181,494,190 T295I probably damaging Het
Amph A G 13: 19,104,298 N319S possibly damaging Het
Ankrd27 A G 7: 35,614,519 D425G probably damaging Het
Atg4b T C 1: 93,784,887 S316P probably damaging Het
Brd4 A G 17: 32,212,947 S649P probably benign Het
Bzw1 T C 1: 58,405,037 S411P probably damaging Het
Dnah6 T C 6: 73,044,728 D3537G probably damaging Het
Dnpep A T 1: 75,315,998 W126R probably damaging Het
Efcab2 T C 1: 178,437,450 V27A probably benign Het
Kctd21 T C 7: 97,347,341 L7P probably damaging Het
Kidins220 C T 12: 24,994,855 T216I probably damaging Het
Lpl T A 8: 68,892,605 M87K probably damaging Het
Lrrc16a T C 13: 24,044,232 E987G probably damaging Het
Ltn1 A G 16: 87,380,803 V1646A probably benign Het
Madcam1 A G 10: 79,666,758 T359A probably benign Het
Muc5ac A G 7: 141,802,948 K1092E possibly damaging Het
Nrg2 T C 18: 36,196,676 E162G probably benign Het
Olfr1333 A T 4: 118,830,091 F117L probably benign Het
Olfr474 T A 7: 107,954,967 S109T probably benign Het
Olfr589 A C 7: 103,155,406 S114A probably damaging Het
Pcdhb5 G T 18: 37,321,583 V339L probably benign Het
Plec A G 15: 76,192,284 W145R unknown Het
Polr3f A G 2: 144,536,310 N201D probably benign Het
Skint5 T C 4: 113,804,942 probably null Het
Slc12a2 A G 18: 57,937,719 I1048V probably benign Het
Tenm4 T C 7: 96,895,407 V2247A probably damaging Het
Tg C T 15: 66,773,398 R2385C probably damaging Het
Tomm70a G T 16: 57,121,967 A36S unknown Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Unc45b A G 11: 82,933,888 I629M possibly damaging Het
Vmn1r16 T C 6: 57,323,439 E66G noncoding transcript Het
Vmn1r189 C T 13: 22,102,131 V179I probably benign Het
Vmn2r105 T G 17: 20,228,513 E134A probably benign Het
Wdr70 G A 15: 7,887,370 A522V probably benign Het
Zcchc11 A G 4: 108,512,150 I636V probably benign Het
Zfp184 T A 13: 21,958,825 C234S probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Sult2a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Sult2a4 APN 7 13984945 missense probably damaging 1.00
IGL00835:Sult2a4 APN 7 13909789 missense probably benign 0.01
IGL02078:Sult2a4 APN 7 13989544 missense probably benign 0.02
IGL02409:Sult2a4 APN 7 13984919 nonsense probably null
IGL02970:Sult2a4 APN 7 13909906 splice site probably benign
IGL03201:Sult2a4 APN 7 13931767 missense probably damaging 0.97
R0827:Sult2a4 UTSW 7 13984961 missense probably benign 0.03
R1484:Sult2a4 UTSW 7 13909801 missense probably benign
R1523:Sult2a4 UTSW 7 13909860 nonsense probably null
R1613:Sult2a4 UTSW 7 13989495 missense probably damaging 0.98
R2127:Sult2a4 UTSW 7 13915260 missense probably damaging 0.99
R2372:Sult2a4 UTSW 7 13915300 missense probably benign 0.15
R3161:Sult2a4 UTSW 7 13989471 missense probably benign 0.17
R5181:Sult2a4 UTSW 7 13988391 missense probably benign 0.04
R7124:Sult2a4 UTSW 7 13988395 nonsense probably null
R7983:Sult2a4 UTSW 7 13915227 missense probably damaging 1.00
X0028:Sult2a4 UTSW 7 13988241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAATCATTGTTCTGGTGC -3'
(R):5'- TTGCTATAAGCTGAATAGGTGTCC -3'

Sequencing Primer
(F):5'- CACAATCATTGTTCTGGTGCCATAG -3'
(R):5'- CTGGGCTGGAATTCTAACAGCATC -3'
Posted On2020-07-13