Incidental Mutation 'R8214:Ankrd27'
ID636309
Institutional Source Beutler Lab
Gene Symbol Ankrd27
Ensembl Gene ENSMUSG00000034867
Gene Nameankyrin repeat domain 27 (VPS9 domain)
SynonymsD330003H11Rik, Varp
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8214 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location35586244-35639226 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35614519 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 425 (D425G)
Ref Sequence ENSEMBL: ENSMUSP00000041751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040844] [ENSMUST00000190503] [ENSMUST00000206472] [ENSMUST00000206632]
Predicted Effect probably damaging
Transcript: ENSMUST00000040844
AA Change: D425G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041751
Gene: ENSMUSG00000034867
AA Change: D425G

DomainStartEndE-ValueType
Blast:ANK 8 37 2e-8 BLAST
VPS9 264 380 1.92e-7 SMART
Blast:ANK 393 418 8e-9 BLAST
low complexity region 419 430 N/A INTRINSIC
ANK 462 491 8.65e-5 SMART
ANK 495 524 1.8e-2 SMART
ANK 528 558 2.45e-4 SMART
ANK 564 593 6.46e-4 SMART
low complexity region 638 658 N/A INTRINSIC
ANK 742 774 8.39e-3 SMART
ANK 775 804 5.93e-3 SMART
ANK 808 837 4.46e-7 SMART
ANK 841 870 2.81e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187807
Predicted Effect probably benign
Transcript: ENSMUST00000190503
AA Change: D425G

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140259
Gene: ENSMUSG00000034867
AA Change: D425G

DomainStartEndE-ValueType
Blast:ANK 8 37 2e-8 BLAST
VPS9 264 380 1.92e-7 SMART
Blast:ANK 393 418 7e-9 BLAST
low complexity region 419 430 N/A INTRINSIC
ANK 462 491 8.65e-5 SMART
ANK 495 524 1.8e-2 SMART
ANK 528 558 2.45e-4 SMART
ANK 564 593 6.46e-4 SMART
low complexity region 638 658 N/A INTRINSIC
ANK 687 719 8.39e-3 SMART
ANK 720 749 5.93e-3 SMART
ANK 753 782 4.46e-7 SMART
ANK 786 815 2.81e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206472
Predicted Effect probably benign
Transcript: ENSMUST00000206632
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,286,621 R52Q Het
Abcc3 C T 11: 94,363,518 R718H probably damaging Het
Abcc4 T C 14: 118,500,841 M1166V probably benign Het
Abhd16b C T 2: 181,494,190 T295I probably damaging Het
Amph A G 13: 19,104,298 N319S possibly damaging Het
Atg4b T C 1: 93,784,887 S316P probably damaging Het
Brd4 A G 17: 32,212,947 S649P probably benign Het
Bzw1 T C 1: 58,405,037 S411P probably damaging Het
Dnah6 T C 6: 73,044,728 D3537G probably damaging Het
Dnpep A T 1: 75,315,998 W126R probably damaging Het
Efcab2 T C 1: 178,437,450 V27A probably benign Het
Kctd21 T C 7: 97,347,341 L7P probably damaging Het
Kidins220 C T 12: 24,994,855 T216I probably damaging Het
Lpl T A 8: 68,892,605 M87K probably damaging Het
Lrrc16a T C 13: 24,044,232 E987G probably damaging Het
Ltn1 A G 16: 87,380,803 V1646A probably benign Het
Madcam1 A G 10: 79,666,758 T359A probably benign Het
Muc5ac A G 7: 141,802,948 K1092E possibly damaging Het
Nrg2 T C 18: 36,196,676 E162G probably benign Het
Olfr1333 A T 4: 118,830,091 F117L probably benign Het
Olfr474 T A 7: 107,954,967 S109T probably benign Het
Olfr589 A C 7: 103,155,406 S114A probably damaging Het
Pcdhb5 G T 18: 37,321,583 V339L probably benign Het
Plec A G 15: 76,192,284 W145R unknown Het
Polr3f A G 2: 144,536,310 N201D probably benign Het
Skint5 T C 4: 113,804,942 probably null Het
Slc12a2 A G 18: 57,937,719 I1048V probably benign Het
Sult2a4 A G 7: 13,989,476 I39T probably benign Het
Tenm4 T C 7: 96,895,407 V2247A probably damaging Het
Tg C T 15: 66,773,398 R2385C probably damaging Het
Tomm70a G T 16: 57,121,967 A36S unknown Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Unc45b A G 11: 82,933,888 I629M possibly damaging Het
Vmn1r16 T C 6: 57,323,439 E66G noncoding transcript Het
Vmn1r189 C T 13: 22,102,131 V179I probably benign Het
Vmn2r105 T G 17: 20,228,513 E134A probably benign Het
Wdr70 G A 15: 7,887,370 A522V probably benign Het
Zcchc11 A G 4: 108,512,150 I636V probably benign Het
Zfp184 T A 13: 21,958,825 C234S probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Ankrd27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Ankrd27 APN 7 35614456 missense probably damaging 0.99
IGL02205:Ankrd27 APN 7 35616939 missense probably damaging 1.00
IGL02372:Ankrd27 APN 7 35633036 splice site probably null
IGL02629:Ankrd27 APN 7 35625696 missense probably benign 0.00
IGL03394:Ankrd27 APN 7 35607098 splice site probably null
R0008:Ankrd27 UTSW 7 35603700 missense probably benign 0.11
R0008:Ankrd27 UTSW 7 35603700 missense probably benign 0.11
R0233:Ankrd27 UTSW 7 35601560 missense probably damaging 1.00
R0233:Ankrd27 UTSW 7 35601560 missense probably damaging 1.00
R0240:Ankrd27 UTSW 7 35619439 missense probably damaging 1.00
R0240:Ankrd27 UTSW 7 35619439 missense probably damaging 1.00
R0281:Ankrd27 UTSW 7 35619371 missense probably damaging 0.98
R0373:Ankrd27 UTSW 7 35638053 missense probably benign 0.00
R0833:Ankrd27 UTSW 7 35608347 missense probably damaging 1.00
R0836:Ankrd27 UTSW 7 35608347 missense probably damaging 1.00
R1191:Ankrd27 UTSW 7 35602487 missense probably damaging 0.96
R1394:Ankrd27 UTSW 7 35615869 missense possibly damaging 0.80
R1395:Ankrd27 UTSW 7 35615869 missense possibly damaging 0.80
R1493:Ankrd27 UTSW 7 35608365 missense probably benign 0.11
R1648:Ankrd27 UTSW 7 35603853 missense probably benign 0.00
R1664:Ankrd27 UTSW 7 35607126 missense probably damaging 1.00
R1698:Ankrd27 UTSW 7 35614521 missense probably benign 0.01
R1717:Ankrd27 UTSW 7 35628446 missense possibly damaging 0.87
R1919:Ankrd27 UTSW 7 35632985 missense probably benign
R1956:Ankrd27 UTSW 7 35603839 missense probably damaging 1.00
R2276:Ankrd27 UTSW 7 35615840 unclassified probably benign
R3000:Ankrd27 UTSW 7 35608330 missense probably damaging 1.00
R4604:Ankrd27 UTSW 7 35628490 missense probably damaging 1.00
R4647:Ankrd27 UTSW 7 35638234 missense probably benign
R4838:Ankrd27 UTSW 7 35591806 missense possibly damaging 0.87
R4896:Ankrd27 UTSW 7 35608375 missense probably damaging 1.00
R4973:Ankrd27 UTSW 7 35632992 missense probably benign
R5004:Ankrd27 UTSW 7 35608375 missense probably damaging 1.00
R5069:Ankrd27 UTSW 7 35628435 missense probably damaging 0.98
R5182:Ankrd27 UTSW 7 35628487 missense probably damaging 1.00
R5330:Ankrd27 UTSW 7 35615926 nonsense probably null
R5458:Ankrd27 UTSW 7 35591811 missense probably damaging 1.00
R6293:Ankrd27 UTSW 7 35608460 missense possibly damaging 0.65
R6341:Ankrd27 UTSW 7 35627403 critical splice acceptor site probably null
R6721:Ankrd27 UTSW 7 35612551 missense probably damaging 1.00
R6860:Ankrd27 UTSW 7 35628527 missense possibly damaging 0.62
R7027:Ankrd27 UTSW 7 35612526 missense probably benign 0.00
R7177:Ankrd27 UTSW 7 35619397 missense probably damaging 1.00
R7231:Ankrd27 UTSW 7 35628446 missense possibly damaging 0.87
R7289:Ankrd27 UTSW 7 35631249 missense probably damaging 1.00
R7933:Ankrd27 UTSW 7 35601649 splice site probably benign
R8011:Ankrd27 UTSW 7 35616881 missense probably benign 0.01
R8198:Ankrd27 UTSW 7 35608455 missense probably benign 0.01
R8327:Ankrd27 UTSW 7 35601560 missense probably damaging 1.00
R8461:Ankrd27 UTSW 7 35627486 missense probably damaging 1.00
R8508:Ankrd27 UTSW 7 35601626 nonsense probably null
Z1177:Ankrd27 UTSW 7 35603878 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TCCATGAGGGAGTGCTTGC -3'
(R):5'- GAAAGTGTGTCACCCCGCAC -3'

Sequencing Primer
(F):5'- TGTGTGACACCCTGGGTC -3'
(R):5'- CACTGGGGACAAGAGCCGAC -3'
Posted On2020-07-13