Incidental Mutation 'R0723:Acin1'
ID63631
Institutional Source Beutler Lab
Gene Symbol Acin1
Ensembl Gene ENSMUSG00000022185
Gene Nameapoptotic chromatin condensation inducer 1
Synonyms2610510L13Rik, Acinus, 2610036I19Rik
MMRRC Submission 038905-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R0723 (G1)
Quality Score153
Status Validated
Chromosome14
Chromosomal Location54642161-54686931 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54665451 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 255 (S255T)
Ref Sequence ENSEMBL: ENSMUSP00000107109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022793] [ENSMUST00000111484] [ENSMUST00000125265]
Predicted Effect probably benign
Transcript: ENSMUST00000022793
AA Change: S295T

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022793
Gene: ENSMUSG00000022185
AA Change: S295T

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 175 N/A INTRINSIC
low complexity region 205 220 N/A INTRINSIC
coiled coil region 259 300 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 414 423 N/A INTRINSIC
low complexity region 573 603 N/A INTRINSIC
low complexity region 631 662 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
low complexity region 760 773 N/A INTRINSIC
low complexity region 778 792 N/A INTRINSIC
low complexity region 803 813 N/A INTRINSIC
internal_repeat_1 817 892 1.63e-6 PROSPERO
low complexity region 927 952 N/A INTRINSIC
RRM 1012 1081 8.3e-2 SMART
Pfam:RSB_motif 1139 1246 5.7e-30 PFAM
low complexity region 1275 1329 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111484
AA Change: S255T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107109
Gene: ENSMUSG00000022185
AA Change: S255T

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 172 N/A INTRINSIC
coiled coil region 219 260 N/A INTRINSIC
low complexity region 338 356 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 591 622 N/A INTRINSIC
low complexity region 694 703 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 738 752 N/A INTRINSIC
low complexity region 763 773 N/A INTRINSIC
internal_repeat_1 777 852 1.21e-6 PROSPERO
low complexity region 887 912 N/A INTRINSIC
RRM 972 1041 8.3e-2 SMART
low complexity region 1073 1123 N/A INTRINSIC
low complexity region 1130 1168 N/A INTRINSIC
coiled coil region 1188 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125265
AA Change: S149T

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120445
Gene: ENSMUSG00000022185
AA Change: S149T

DomainStartEndE-ValueType
Blast:BRLZ 1 27 3e-9 BLAST
coiled coil region 32 66 N/A INTRINSIC
coiled coil region 113 154 N/A INTRINSIC
low complexity region 232 250 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141993
Predicted Effect unknown
Transcript: ENSMUST00000147714
AA Change: S240T
SMART Domains Protein: ENSMUSP00000119080
Gene: ENSMUSG00000022185
AA Change: S240T

DomainStartEndE-ValueType
SAP 18 52 1.29e-8 SMART
coiled coil region 83 120 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
coiled coil region 204 245 N/A INTRINSIC
low complexity region 324 342 N/A INTRINSIC
low complexity region 360 369 N/A INTRINSIC
low complexity region 519 549 N/A INTRINSIC
low complexity region 577 608 N/A INTRINSIC
low complexity region 680 689 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
low complexity region 724 738 N/A INTRINSIC
low complexity region 749 759 N/A INTRINSIC
low complexity region 861 886 N/A INTRINSIC
RRM 946 1015 8.3e-2 SMART
Pfam:RSB_motif 1065 1180 1.1e-29 PFAM
low complexity region 1209 1263 N/A INTRINSIC
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoptosis is defined by several morphologic nuclear changes, including chromatin condensation and nuclear fragmentation. This gene encodes a nuclear protein that induces apoptotic chromatin condensation after activation by caspase-3, without inducing DNA fragmentation. This protein has also been shown to be a component of a splicing-dependent multiprotein exon junction complex (EJC) that is deposited at splice junctions on mRNAs, as a consequence of pre-mRNA splicing. It may thus be involved in mRNA metabolism associated with splicing. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,691 N341K probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4931423N10Rik T C 2: 23,256,924 probably benign Het
8030411F24Rik T C 2: 148,783,362 I72T probably damaging Het
Acbd5 T G 2: 23,069,596 V54G probably damaging Het
Adcy2 A G 13: 68,999,129 L56P probably damaging Het
Akap6 G T 12: 53,141,902 C2033F probably damaging Het
Ano5 A G 7: 51,587,758 I777V probably benign Het
Arhgef28 A G 13: 97,939,479 V1349A probably benign Het
Bank1 T C 3: 136,054,403 probably null Het
C2cd5 T C 6: 143,041,555 probably benign Het
Cadps2 A G 6: 23,287,698 V1161A probably damaging Het
Car8 A T 4: 8,169,703 D268E probably benign Het
Ckap5 T A 2: 91,555,331 S175T probably damaging Het
Clk4 T A 11: 51,275,493 Y67* probably null Het
Copg2 T C 6: 30,815,982 I473V possibly damaging Het
Cyp2s1 C T 7: 25,809,548 V43I probably benign Het
Ddx54 A G 5: 120,623,638 D493G probably benign Het
Efemp2 T C 19: 5,480,050 S140P probably damaging Het
Fam214a G A 9: 75,009,451 G444E probably damaging Het
Fat1 C A 8: 45,026,749 T2944K probably damaging Het
Fgfr1 T A 8: 25,557,768 D43E probably damaging Het
Fry G A 5: 150,496,360 A996T probably damaging Het
Fyb2 G A 4: 105,015,866 V784I probably benign Het
Gm6507 T A 6: 89,185,162 noncoding transcript Het
Gm7964 T C 7: 83,756,166 noncoding transcript Het
Gucy2c T C 6: 136,727,801 probably null Het
Hdac10 A T 15: 89,126,418 L259Q probably damaging Het
Hoxd9 A T 2: 74,698,828 D258V probably damaging Het
Hs3st3b1 T C 11: 63,921,575 T105A probably benign Het
Hsd17b7 A G 1: 169,956,026 L271P probably damaging Het
Ifnlr1 T A 4: 135,701,213 probably benign Het
Kif22 A T 7: 127,033,906 M121K probably damaging Het
Kl G A 5: 150,953,101 D129N probably damaging Het
Mettl13 A T 1: 162,534,430 I648N probably damaging Het
Mlh1 C T 9: 111,271,472 R18H probably damaging Het
Mtmr14 T C 6: 113,270,512 probably benign Het
Myo15 C A 11: 60,478,977 N854K possibly damaging Het
Myo1h T C 5: 114,319,680 I84T probably benign Het
Myo9a A T 9: 59,871,100 S1380C probably benign Het
Myof A G 19: 37,981,260 V318A probably damaging Het
N4bp2l2 A G 5: 150,662,432 S28P probably damaging Het
Narfl G A 17: 25,781,821 V406M probably damaging Het
Nbr1 C T 11: 101,576,319 Q570* probably null Het
Nhp2 C T 11: 51,619,923 Q36* probably null Het
Olfr23 T G 11: 73,940,270 V8G probably benign Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Poc1b T A 10: 99,129,595 W129R probably damaging Het
Rapgef2 C T 3: 79,079,174 E1018K probably benign Het
Rgs12 T C 5: 35,024,366 probably benign Het
Rufy2 G A 10: 62,998,094 V280I probably benign Het
Snx2 A G 18: 53,210,372 I281V probably benign Het
Spag5 C A 11: 78,319,584 probably benign Het
Stxbp5 A T 10: 9,768,873 I961N probably damaging Het
Tet2 T C 3: 133,467,284 E1739G probably benign Het
Tmod2 A G 9: 75,595,055 F50S possibly damaging Het
Tnfsf13b T G 8: 10,007,166 probably null Het
Ttn T C 2: 76,786,335 K16525E possibly damaging Het
Txnrd2 T C 16: 18,440,879 probably benign Het
Ubr1 A T 2: 120,881,101 Y1437* probably null Het
Vwf C A 6: 125,566,262 D170E probably benign Het
Wdr95 C G 5: 149,574,048 I230M probably damaging Het
Xirp2 C T 2: 67,512,215 S1600F probably damaging Het
Zfp12 A G 5: 143,244,883 K322E probably damaging Het
Other mutations in Acin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Acin1 APN 14 54646800 missense probably damaging 1.00
IGL01530:Acin1 APN 14 54643986 missense probably damaging 1.00
IGL02396:Acin1 APN 14 54644799 intron probably benign
IGL02967:Acin1 APN 14 54642753 missense possibly damaging 0.80
Protuberant UTSW 14 54645283 missense probably damaging 1.00
R0411:Acin1 UTSW 14 54646774 missense probably damaging 1.00
R0755:Acin1 UTSW 14 54651835 start codon destroyed probably null 0.93
R0784:Acin1 UTSW 14 54653528 unclassified probably benign
R1600:Acin1 UTSW 14 54643717 intron probably benign
R1682:Acin1 UTSW 14 54663718 missense probably damaging 1.00
R1721:Acin1 UTSW 14 54664538 missense probably benign 0.01
R1756:Acin1 UTSW 14 54665204 missense probably benign 0.30
R1867:Acin1 UTSW 14 54644261 missense probably damaging 1.00
R1997:Acin1 UTSW 14 54646699 splice site probably null
R2067:Acin1 UTSW 14 54665254 missense probably damaging 1.00
R3947:Acin1 UTSW 14 54679333 missense possibly damaging 0.89
R4374:Acin1 UTSW 14 54653894 unclassified probably benign
R4476:Acin1 UTSW 14 54645330 missense probably damaging 1.00
R4501:Acin1 UTSW 14 54686587 missense probably damaging 1.00
R4547:Acin1 UTSW 14 54645667 missense probably benign 0.01
R4621:Acin1 UTSW 14 54653443 unclassified probably benign
R4657:Acin1 UTSW 14 54643047 missense possibly damaging 0.93
R4680:Acin1 UTSW 14 54686758 missense probably benign 0.00
R4696:Acin1 UTSW 14 54643017 intron probably benign
R4806:Acin1 UTSW 14 54679228 splice site probably benign
R4826:Acin1 UTSW 14 54664617 missense probably damaging 0.97
R5096:Acin1 UTSW 14 54679222 intron probably benign
R5153:Acin1 UTSW 14 54645613 missense probably benign 0.25
R5223:Acin1 UTSW 14 54642941 frame shift probably null
R5260:Acin1 UTSW 14 54642822 intron probably benign
R5525:Acin1 UTSW 14 54664391 missense possibly damaging 0.94
R5575:Acin1 UTSW 14 54678738 splice site probably null
R5902:Acin1 UTSW 14 54663673 missense probably benign 0.01
R6211:Acin1 UTSW 14 54644046 missense probably damaging 1.00
R6524:Acin1 UTSW 14 54645283 missense probably damaging 1.00
R6560:Acin1 UTSW 14 54678833 missense probably benign 0.24
R6916:Acin1 UTSW 14 54665416 missense probably benign 0.27
R7201:Acin1 UTSW 14 54664899 missense possibly damaging 0.83
R7833:Acin1 UTSW 14 54664602 missense possibly damaging 0.83
R7916:Acin1 UTSW 14 54664602 missense possibly damaging 0.83
X0021:Acin1 UTSW 14 54667101 missense probably damaging 1.00
Z1177:Acin1 UTSW 14 54642750 missense not run
Predicted Primers PCR Primer
(F):5'- TTGGGATCTAGTAACTCGCCCTCC -3'
(R):5'- AAGCAGCTTCCTTACCGTGCTC -3'

Sequencing Primer
(F):5'- GTAACTCGCCCTCCTTTCTCTAAC -3'
(R):5'- TTCCCAAGAGTGCCTTGAGAG -3'
Posted On2013-07-30