Incidental Mutation 'R8214:Madcam1'
ID636317
Institutional Source Beutler Lab
Gene Symbol Madcam1
Ensembl Gene ENSMUSG00000020310
Gene Namemucosal vascular addressin cell adhesion molecule 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8214 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79664559-79668537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79666758 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 359 (T359A)
Ref Sequence ENSEMBL: ENSMUSP00000020554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020552] [ENSMUST00000020554]
Predicted Effect probably benign
Transcript: ENSMUST00000020552
SMART Domains Protein: ENSMUSP00000020552
Gene: ENSMUSG00000020308

DomainStartEndE-ValueType
low complexity region 94 114 N/A INTRINSIC
Blast:UBCc 125 156 9e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000020554
AA Change: T359A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020554
Gene: ENSMUSG00000020310
AA Change: T359A

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:ICAM_N 21 114 7.3e-8 PFAM
Pfam:Adhes-Ig_like 110 220 2.4e-57 PFAM
Blast:IG_like 278 354 3e-14 BLAST
transmembrane domain 366 388 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit small Peyer's patches and decreased homing of IgA-secreting plasma cells in the lamina propria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,286,621 R52Q Het
Abcc3 C T 11: 94,363,518 R718H probably damaging Het
Abcc4 T C 14: 118,500,841 M1166V probably benign Het
Abhd16b C T 2: 181,494,190 T295I probably damaging Het
Amph A G 13: 19,104,298 N319S possibly damaging Het
Ankrd27 A G 7: 35,614,519 D425G probably damaging Het
Atg4b T C 1: 93,784,887 S316P probably damaging Het
Brd4 A G 17: 32,212,947 S649P probably benign Het
Bzw1 T C 1: 58,405,037 S411P probably damaging Het
Dnah6 T C 6: 73,044,728 D3537G probably damaging Het
Dnpep A T 1: 75,315,998 W126R probably damaging Het
Efcab2 T C 1: 178,437,450 V27A probably benign Het
Kctd21 T C 7: 97,347,341 L7P probably damaging Het
Kidins220 C T 12: 24,994,855 T216I probably damaging Het
Lpl T A 8: 68,892,605 M87K probably damaging Het
Lrrc16a T C 13: 24,044,232 E987G probably damaging Het
Ltn1 A G 16: 87,380,803 V1646A probably benign Het
Muc5ac A G 7: 141,802,948 K1092E possibly damaging Het
Nrg2 T C 18: 36,196,676 E162G probably benign Het
Olfr1333 A T 4: 118,830,091 F117L probably benign Het
Olfr474 T A 7: 107,954,967 S109T probably benign Het
Olfr589 A C 7: 103,155,406 S114A probably damaging Het
Pcdhb5 G T 18: 37,321,583 V339L probably benign Het
Plec A G 15: 76,192,284 W145R unknown Het
Polr3f A G 2: 144,536,310 N201D probably benign Het
Skint5 T C 4: 113,804,942 probably null Het
Slc12a2 A G 18: 57,937,719 I1048V probably benign Het
Sult2a4 A G 7: 13,989,476 I39T probably benign Het
Tenm4 T C 7: 96,895,407 V2247A probably damaging Het
Tg C T 15: 66,773,398 R2385C probably damaging Het
Tomm70a G T 16: 57,121,967 A36S unknown Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Unc45b A G 11: 82,933,888 I629M possibly damaging Het
Vmn1r16 T C 6: 57,323,439 E66G noncoding transcript Het
Vmn1r189 C T 13: 22,102,131 V179I probably benign Het
Vmn2r105 T G 17: 20,228,513 E134A probably benign Het
Wdr70 G A 15: 7,887,370 A522V probably benign Het
Zcchc11 A G 4: 108,512,150 I636V probably benign Het
Zfp184 T A 13: 21,958,825 C234S probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Madcam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1491:Madcam1 UTSW 10 79666524 missense probably benign 0.03
R2128:Madcam1 UTSW 10 79665572 missense possibly damaging 0.93
R2129:Madcam1 UTSW 10 79665572 missense possibly damaging 0.93
R3713:Madcam1 UTSW 10 79668360 missense probably benign
R4932:Madcam1 UTSW 10 79665613 nonsense probably null
R5212:Madcam1 UTSW 10 79668345 missense probably benign 0.22
R5256:Madcam1 UTSW 10 79664945 missense possibly damaging 0.72
R5849:Madcam1 UTSW 10 79664990 missense probably benign 0.02
R6816:Madcam1 UTSW 10 79665440 missense probably damaging 1.00
R7046:Madcam1 UTSW 10 79668305 missense probably benign 0.34
R7209:Madcam1 UTSW 10 79665058 missense possibly damaging 0.53
R7994:Madcam1 UTSW 10 79668235 critical splice acceptor site probably null
R8956:Madcam1 UTSW 10 79666632 missense possibly damaging 0.53
X0017:Madcam1 UTSW 10 79664999 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTACTCTGTGAAGCATCCTGTG -3'
(R):5'- CCGGGCATCTGAAACCAATG -3'

Sequencing Primer
(F):5'- TGAAGCATCCTGTGGGCCC -3'
(R):5'- ACTTTTTGTTTCACTGGATCTTCCTG -3'
Posted On2020-07-13