Incidental Mutation 'R8214:4930438A08Rik'
ID636318
Institutional Source Beutler Lab
Gene Symbol 4930438A08Rik
Ensembl Gene ENSMUSG00000069873
Gene NameRIKEN cDNA 4930438A08 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8214 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58274799-58294289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58286621 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 52 (R52Q)
Ref Sequence ENSEMBL: ENSMUSP00000104462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108834] [ENSMUST00000208022]
Predicted Effect
SMART Domains Protein: ENSMUSP00000104462
Gene: ENSMUSG00000069873
AA Change: R52Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pyr_redox_2 29 166 2e-8 PFAM
Pfam:AlaDh_PNT_C 48 124 8.8e-8 PFAM
Pfam:FAD_binding_3 61 98 1.9e-7 PFAM
Pfam:HI0933_like 62 103 3.1e-8 PFAM
Pfam:Pyr_redox 63 105 1.8e-7 PFAM
Pfam:FAD_binding_2 63 119 8.7e-9 PFAM
Pfam:DAO 63 212 2.9e-8 PFAM
Pfam:NAD_binding_8 66 133 7.1e-15 PFAM
Pfam:Amino_oxidase 71 270 7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208022
AA Change: R52Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 C T 11: 94,363,518 R718H probably damaging Het
Abcc4 T C 14: 118,500,841 M1166V probably benign Het
Abhd16b C T 2: 181,494,190 T295I probably damaging Het
Amph A G 13: 19,104,298 N319S possibly damaging Het
Ankrd27 A G 7: 35,614,519 D425G probably damaging Het
Atg4b T C 1: 93,784,887 S316P probably damaging Het
Brd4 A G 17: 32,212,947 S649P probably benign Het
Bzw1 T C 1: 58,405,037 S411P probably damaging Het
Dnah6 T C 6: 73,044,728 D3537G probably damaging Het
Dnpep A T 1: 75,315,998 W126R probably damaging Het
Efcab2 T C 1: 178,437,450 V27A probably benign Het
Kctd21 T C 7: 97,347,341 L7P probably damaging Het
Kidins220 C T 12: 24,994,855 T216I probably damaging Het
Lpl T A 8: 68,892,605 M87K probably damaging Het
Lrrc16a T C 13: 24,044,232 E987G probably damaging Het
Ltn1 A G 16: 87,380,803 V1646A probably benign Het
Madcam1 A G 10: 79,666,758 T359A probably benign Het
Muc5ac A G 7: 141,802,948 K1092E possibly damaging Het
Nrg2 T C 18: 36,196,676 E162G probably benign Het
Olfr1333 A T 4: 118,830,091 F117L probably benign Het
Olfr474 T A 7: 107,954,967 S109T probably benign Het
Olfr589 A C 7: 103,155,406 S114A probably damaging Het
Pcdhb5 G T 18: 37,321,583 V339L probably benign Het
Plec A G 15: 76,192,284 W145R unknown Het
Polr3f A G 2: 144,536,310 N201D probably benign Het
Skint5 T C 4: 113,804,942 probably null Het
Slc12a2 A G 18: 57,937,719 I1048V probably benign Het
Sult2a4 A G 7: 13,989,476 I39T probably benign Het
Tenm4 T C 7: 96,895,407 V2247A probably damaging Het
Tg C T 15: 66,773,398 R2385C probably damaging Het
Tomm70a G T 16: 57,121,967 A36S unknown Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Unc45b A G 11: 82,933,888 I629M possibly damaging Het
Vmn1r16 T C 6: 57,323,439 E66G noncoding transcript Het
Vmn1r189 C T 13: 22,102,131 V179I probably benign Het
Vmn2r105 T G 17: 20,228,513 E134A probably benign Het
Wdr70 G A 15: 7,887,370 A522V probably benign Het
Zcchc11 A G 4: 108,512,150 I636V probably benign Het
Zfp184 T A 13: 21,958,825 C234S probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in 4930438A08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02884:4930438A08Rik APN 11 58287476 missense probably benign 0.01
IGL03088:4930438A08Rik APN 11 58293384 missense unknown
R0715:4930438A08Rik UTSW 11 58288350 missense probably damaging 1.00
R1139:4930438A08Rik UTSW 11 58288286 missense probably damaging 1.00
R1833:4930438A08Rik UTSW 11 58288388 nonsense probably null
R5906:4930438A08Rik UTSW 11 58291434 splice site probably null
R6056:4930438A08Rik UTSW 11 58293638 missense probably damaging 0.96
R6288:4930438A08Rik UTSW 11 58293595 missense probably damaging 1.00
R6981:4930438A08Rik UTSW 11 58293718 unclassified probably benign
R6989:4930438A08Rik UTSW 11 58287402 missense possibly damaging 0.88
R7195:4930438A08Rik UTSW 11 58288416 critical splice donor site probably null
R7344:4930438A08Rik UTSW 11 58291447 missense
R7651:4930438A08Rik UTSW 11 58293362 missense
R8141:4930438A08Rik UTSW 11 58286585 missense
R8187:4930438A08Rik UTSW 11 58289722 missense
R8228:4930438A08Rik UTSW 11 58291555 missense
R8744:4930438A08Rik UTSW 11 58291434 splice site probably null
Z1186:4930438A08Rik UTSW 11 58294018 missense unknown
Z1187:4930438A08Rik UTSW 11 58294018 missense unknown
Z1188:4930438A08Rik UTSW 11 58294018 missense unknown
Z1189:4930438A08Rik UTSW 11 58294018 missense unknown
Z1190:4930438A08Rik UTSW 11 58294018 missense unknown
Z1191:4930438A08Rik UTSW 11 58294018 missense unknown
Z1192:4930438A08Rik UTSW 11 58294018 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGATCAAGGGTTATGGCCAGTC -3'
(R):5'- CCCTAGAGCTTCATTTGGCC -3'

Sequencing Primer
(F):5'- GGGTTATGGCCAGTCCTCCTTC -3'
(R):5'- GCTCCAAGGAATGTCCATAGCTTG -3'
Posted On2020-07-13