Incidental Mutation 'R8214:Unc45b'
ID636319
Institutional Source Beutler Lab
Gene Symbol Unc45b
Ensembl Gene ENSMUSG00000018845
Gene Nameunc-45 myosin chaperone B
SynonymsCmya4, D230041A13Rik, UNC45
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8214 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location82910550-82943403 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82933888 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 629 (I629M)
Ref Sequence ENSEMBL: ENSMUSP00000018989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018989] [ENSMUST00000108160] [ENSMUST00000164945]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018989
AA Change: I629M

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000018989
Gene: ENSMUSG00000018845
AA Change: I629M

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 298 489 1.7e-41 PFAM
Blast:ARM 541 582 7e-7 BLAST
Blast:ARM 661 701 2e-14 BLAST
Blast:ARM 704 746 5e-11 BLAST
Blast:ARM 747 788 1e-20 BLAST
Blast:ARM 789 820 1e-11 BLAST
low complexity region 821 832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108160
AA Change: I631M

PolyPhen 2 Score 0.291 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103795
Gene: ENSMUSG00000018845
AA Change: I631M

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 271 489 2.2e-52 PFAM
Blast:ARM 663 703 2e-14 BLAST
Blast:ARM 706 748 5e-11 BLAST
Blast:ARM 749 790 1e-20 BLAST
Blast:ARM 791 822 1e-11 BLAST
low complexity region 823 834 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164945
AA Change: I631M

PolyPhen 2 Score 0.291 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129405
Gene: ENSMUSG00000018845
AA Change: I631M

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 298 489 1.7e-41 PFAM
Blast:ARM 663 703 2e-14 BLAST
Blast:ARM 706 748 5e-11 BLAST
Blast:ARM 749 790 1e-20 BLAST
Blast:ARM 791 822 1e-11 BLAST
low complexity region 823 834 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a co-chaperone required for folding and accumulation of type II myosins. The protein consists of three tetratricopeptide repeat motifs at the N-terminus that form a complex with heat shock protein 90, a central region of unknown function that is conserved in all Unc-45 proteins, and a C-terminal Unc-45/Cro1/She4 domain. The protein is expressed at high levels in striated muscle, where its muscle myosin chaperone activity is dependent on heat shock protein 90 acting as a co-chaperone. A missense mutation in this gene has been associated with cataract development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E9 without placental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,286,621 R52Q Het
Abcc3 C T 11: 94,363,518 R718H probably damaging Het
Abcc4 T C 14: 118,500,841 M1166V probably benign Het
Abhd16b C T 2: 181,494,190 T295I probably damaging Het
Amph A G 13: 19,104,298 N319S possibly damaging Het
Ankrd27 A G 7: 35,614,519 D425G probably damaging Het
Atg4b T C 1: 93,784,887 S316P probably damaging Het
Brd4 A G 17: 32,212,947 S649P probably benign Het
Bzw1 T C 1: 58,405,037 S411P probably damaging Het
Dnah6 T C 6: 73,044,728 D3537G probably damaging Het
Dnpep A T 1: 75,315,998 W126R probably damaging Het
Efcab2 T C 1: 178,437,450 V27A probably benign Het
Kctd21 T C 7: 97,347,341 L7P probably damaging Het
Kidins220 C T 12: 24,994,855 T216I probably damaging Het
Lpl T A 8: 68,892,605 M87K probably damaging Het
Lrrc16a T C 13: 24,044,232 E987G probably damaging Het
Ltn1 A G 16: 87,380,803 V1646A probably benign Het
Madcam1 A G 10: 79,666,758 T359A probably benign Het
Muc5ac A G 7: 141,802,948 K1092E possibly damaging Het
Nrg2 T C 18: 36,196,676 E162G probably benign Het
Olfr1333 A T 4: 118,830,091 F117L probably benign Het
Olfr474 T A 7: 107,954,967 S109T probably benign Het
Olfr589 A C 7: 103,155,406 S114A probably damaging Het
Pcdhb5 G T 18: 37,321,583 V339L probably benign Het
Plec A G 15: 76,192,284 W145R unknown Het
Polr3f A G 2: 144,536,310 N201D probably benign Het
Skint5 T C 4: 113,804,942 probably null Het
Slc12a2 A G 18: 57,937,719 I1048V probably benign Het
Sult2a4 A G 7: 13,989,476 I39T probably benign Het
Tenm4 T C 7: 96,895,407 V2247A probably damaging Het
Tg C T 15: 66,773,398 R2385C probably damaging Het
Tomm70a G T 16: 57,121,967 A36S unknown Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Vmn1r16 T C 6: 57,323,439 E66G noncoding transcript Het
Vmn1r189 C T 13: 22,102,131 V179I probably benign Het
Vmn2r105 T G 17: 20,228,513 E134A probably benign Het
Wdr70 G A 15: 7,887,370 A522V probably benign Het
Zcchc11 A G 4: 108,512,150 I636V probably benign Het
Zfp184 T A 13: 21,958,825 C234S probably damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Unc45b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Unc45b APN 11 82912393 critical splice acceptor site probably null
IGL01983:Unc45b APN 11 82936861 missense probably benign
IGL02083:Unc45b APN 11 82922919 missense probably damaging 0.96
IGL02159:Unc45b APN 11 82940181 splice site probably benign
IGL02160:Unc45b APN 11 82940181 splice site probably benign
IGL02165:Unc45b APN 11 82940181 splice site probably benign
IGL02166:Unc45b APN 11 82940181 splice site probably benign
IGL02986:Unc45b APN 11 82917179 missense probably damaging 0.98
fife UTSW 11 82936852 missense probably benign 0.00
R0195:Unc45b UTSW 11 82937828 missense probably damaging 1.00
R0197:Unc45b UTSW 11 82940205 missense possibly damaging 0.78
R0218:Unc45b UTSW 11 82911860 splice site probably benign
R0436:Unc45b UTSW 11 82929567 splice site probably benign
R0569:Unc45b UTSW 11 82936812 splice site probably benign
R0701:Unc45b UTSW 11 82940205 missense possibly damaging 0.78
R0883:Unc45b UTSW 11 82940205 missense possibly damaging 0.78
R1146:Unc45b UTSW 11 82922907 missense probably damaging 0.99
R1146:Unc45b UTSW 11 82922907 missense probably damaging 0.99
R1378:Unc45b UTSW 11 82936852 missense probably benign 0.00
R1446:Unc45b UTSW 11 82928670 missense probably damaging 1.00
R1532:Unc45b UTSW 11 82936874 missense probably benign 0.12
R1559:Unc45b UTSW 11 82917846 missense possibly damaging 0.66
R1582:Unc45b UTSW 11 82925945 missense probably benign 0.30
R1628:Unc45b UTSW 11 82929380 splice site probably null
R1666:Unc45b UTSW 11 82917739 missense probably benign 0.31
R1677:Unc45b UTSW 11 82911705 splice site probably null
R1759:Unc45b UTSW 11 82929499 missense probably benign 0.33
R1909:Unc45b UTSW 11 82926087 missense probably damaging 1.00
R2067:Unc45b UTSW 11 82911689 missense probably benign 0.01
R2111:Unc45b UTSW 11 82911689 missense probably benign 0.01
R2145:Unc45b UTSW 11 82917754 missense probably benign 0.30
R2258:Unc45b UTSW 11 82917799 missense probably benign 0.01
R2259:Unc45b UTSW 11 82917799 missense probably benign 0.01
R2497:Unc45b UTSW 11 82936443 missense probably damaging 1.00
R2507:Unc45b UTSW 11 82940137 splice site probably null
R4352:Unc45b UTSW 11 82913209 missense probably damaging 0.99
R4569:Unc45b UTSW 11 82936489 critical splice donor site probably null
R4624:Unc45b UTSW 11 82926009 missense probably benign 0.30
R5236:Unc45b UTSW 11 82915062 missense possibly damaging 0.53
R5512:Unc45b UTSW 11 82915072 missense possibly damaging 0.47
R5688:Unc45b UTSW 11 82922817 missense possibly damaging 0.88
R6029:Unc45b UTSW 11 82913327 missense probably damaging 1.00
R6616:Unc45b UTSW 11 82911819 missense probably damaging 1.00
R6857:Unc45b UTSW 11 82913212 missense probably benign 0.00
R6876:Unc45b UTSW 11 82922912 missense probably benign 0.00
R7197:Unc45b UTSW 11 82940187 critical splice acceptor site probably null
R7368:Unc45b UTSW 11 82942495 missense probably benign 0.01
R7531:Unc45b UTSW 11 82929012 missense probably damaging 1.00
R7743:Unc45b UTSW 11 82922900 missense probably damaging 1.00
R8198:Unc45b UTSW 11 82925988 frame shift probably null
R8235:Unc45b UTSW 11 82919855 missense probably benign 0.01
R8916:Unc45b UTSW 11 82913212 missense probably benign 0.00
T0970:Unc45b UTSW 11 82922888 missense probably benign 0.00
Z1176:Unc45b UTSW 11 82928654 critical splice acceptor site probably null
Z1176:Unc45b UTSW 11 82942715 missense probably damaging 1.00
Z1177:Unc45b UTSW 11 82942553 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAGGTTTAAGCACATTTCCAG -3'
(R):5'- ACCTCCCAGATGCAAGTTTTC -3'

Sequencing Primer
(F):5'- TTTCCAGAGAGTATGCACCATGC -3'
(R):5'- CCCAGATGCAAGTTTTCAACTGTGG -3'
Posted On2020-07-13